Rh3BG355500

Homeobox-leucine zipper protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
42223946 .. 42225558
1613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG355500.1

Sequence Viewer

Length: 246 bp
ATGGCTTTGTCCTGCACGGATGGTAAAGGAGTAATGGATAATGGCAAGTATGTGAGGTACAAACCTGAGCAGGTTGTTGAAGCCCTTGAGAGGCTTTATCATGAATGCCCCAAACCCAGTTCGATTCGTTGCCAACAGCTCTTTAAGGAGTACCCAATTCTCTTTAACATTGAGCCTAGCCAAATCAAAATTTTGGTTCCAGAACAGAAGATGCAAAGAAAACTAACATGGAGGGATCCACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.55

Weight (kDa)

8.84

Isoelectric Point (pI)

58.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 61
AclWI GGATC 2 cut(s) 230, 243
AcsI RAATTY 1 cut(s) 189
AfaI GTAC 2 cut(s) 59, 152
AfiI CCNNNNNNNGG 1 cut(s) 90
AgsI TTSAA 1 cut(s) 80
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
AlwI GGATC 2 cut(s) 230, 243
ApoI RAATTY 1 cut(s) 189
BamHI GGATCC 1 cut(s) 235
BccI CCATC 1 cut(s) 14
BfaI CTAG 1 cut(s) 177
BfuAI ACCTGC 1 cut(s) 61
BmiI GGNNCC 2 cut(s) 198, 237
BmrI ACTGGG 1 cut(s) 111
BmsI GCATC 1 cut(s) 201
BmuI ACTGGG 1 cut(s) 111
Bpu10I CCTNAGC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 107
Bsc4I CCNNNNNNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 117
BslI CCNNNNNNNGG 1 cut(s) 90
BsmI GAATGC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 235
BspCNI CTCAG 1 cut(s) 58
BspHI TCATGA 1 cut(s) 100
BspLI GGNNCC 2 cut(s) 198, 237
BspMI ACCTGC 1 cut(s) 61
BspPI GGATC 2 cut(s) 230, 243
BsrI ACTGG 1 cut(s) 117
BssMI GATC 1 cut(s) 235
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 1 cut(s) 238
BstMBI GATC 1 cut(s) 235
BstX2I RGATCY 1 cut(s) 235
BstYI RGATCY 1 cut(s) 235
BtsCI GGATG 1 cut(s) 25
BveI ACCTGC 1 cut(s) 61
CciI TCATGA 1 cut(s) 100
Csp6I GTAC 2 cut(s) 58, 151
CviAII CATG 2 cut(s) 101, 228
CviJI RGCY 6 cut(s) 5, 83, 94, 139, 175, 180
CviKI_1 RGCY 6 cut(s) 5, 83, 94, 139, 175, 180
CviQI GTAC 2 cut(s) 58, 151
DdeI CTNAG 1 cut(s) 66
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
FaeI CATG 2 cut(s) 104, 231
FaiI YATR 3 cut(s) 51, 102, 229
FatI CATG 2 cut(s) 100, 227
FokI GGATG 1 cut(s) 32
FspBI CTAG 1 cut(s) 177
Hin1II CATG 2 cut(s) 104, 231
HinfI GANTC 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 101, 200
HpyCH4V TGCA 2 cut(s) 15, 214
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 2 cut(s) 104, 231
Kzo9I GATC 1 cut(s) 235
LpnPI CCDG 5 cut(s) 25, 56, 78, 130, 213
LweI GCATC 1 cut(s) 201
MaeI CTAG 1 cut(s) 177
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 1 cut(s) 220
MflI RGATCY 1 cut(s) 235
MluCI AATT 2 cut(s) 156, 189
MnlI CCTC 3 cut(s) 48, 84, 225
MseI TTAA 2 cut(s) 144, 165
Mva1269I GAATGC 1 cut(s) 110
NdeII GATC 1 cut(s) 235
NlaIII CATG 2 cut(s) 104, 231
NlaIV GGNNCC 2 cut(s) 198, 237
PagI TCATGA 1 cut(s) 100
PctI GAATGC 1 cut(s) 110
PfeI GAWTC 1 cut(s) 124
PspN4I GGNNCC 2 cut(s) 198, 237
PsuI RGATCY 1 cut(s) 235
RsaI GTAC 2 cut(s) 59, 152
RsaNI GTAC 2 cut(s) 58, 151
SaqAI TTAA 2 cut(s) 144, 165
Sau3AI GATC 1 cut(s) 235
SetI ASST 4 cut(s) 59, 67, 75, 141
SfaNI GCATC 1 cut(s) 201
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 2 cut(s) 156, 189
SspMI CTAG 1 cut(s) 177
TaqI TCGA 1 cut(s) 122
TasI AATT 2 cut(s) 156, 189
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 2 cut(s) 144, 165
Tru9I TTAA 2 cut(s) 144, 165
TspDTI ATGAA 1 cut(s) 117
TspGWI ACGGA 1 cut(s) 32
XapI RAATTY 1 cut(s) 189
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.