Rh5BG491200

Homeobox-leucine zipper protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0005555
Physical Location & Seq
Reverse (-)
78180383 .. 78182317
1935 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG491200.1

Sequence Viewer

Length: 282 bp
ATGTCCTGCACGGATGGTAAAGGAGTAATGGATAATGGCAAGTATGTGAGGTACAAACCTGAGCAGGTTGTTGAAGGCCTTGAGAGGCTTTATCATGAATGCTCCAAACCCAGTTTGATTCGTCGCCAACAGCTCATTAAGGAGTACCCAATTCTCTCTAACATTGAGCCTAGCCAAATCAAAGTTTGGTTCCAGAACAGAAGTGTAGGACCTATTTGCTATAGAGAGAAGAAGAGTGGTGGAGAAGGAGATAGACACAAAGAAGAACATAGCTATCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Homeobox MEKHLA START

Protein Analysis

93

Amino Acids

10.89

Weight (kDa)

8.79

Isoelectric Point (pI)

61.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Homeodomain PF00046 15 - 67 1e-09 Homeodomain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 55
AfaI GTAC 2 cut(s) 53, 146
AgsI TTSAA 1 cut(s) 74
AluBI AGCT 2 cut(s) 133, 273
AluI AGCT 2 cut(s) 133, 273
AoxI GGCC 1 cut(s) 76
AspS9I GGNCC 1 cut(s) 209
AvaII GGWCC 1 cut(s) 209
BccI CCATC 1 cut(s) 8
BfaI CTAG 1 cut(s) 171
BfmI CTRYAG 1 cut(s) 220
BfuAI ACCTGC 1 cut(s) 55
Bme18I GGWCC 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 209
BmiI GGNNCC 1 cut(s) 191
BmrI ACTGGG 1 cut(s) 105
BmuI ACTGGG 1 cut(s) 105
Bpu10I CCTNAGC 1 cut(s) 60
BpuEI CTTGAG 1 cut(s) 101
Bse1I ACTGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 51
BseNI ACTGG 1 cut(s) 111
BshFI GGCC 1 cut(s) 78
BsmI GAATGC 1 cut(s) 104
BsnI GGCC 1 cut(s) 78
BspANI GGCC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 52
BspHI TCATGA 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 191
BspMI ACCTGC 1 cut(s) 55
BsrI ACTGG 1 cut(s) 111
Bst6I CTCTTC 1 cut(s) 227
BstDEI CTNAG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 220
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 19
BveI ACCTGC 1 cut(s) 55
CciI TCATGA 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 209
Csp6I GTAC 2 cut(s) 52, 145
CviAII CATG 1 cut(s) 95
CviJI RGCY 6 cut(s) 78, 88, 133, 169, 174, 273
CviKI_1 RGCY 6 cut(s) 78, 88, 133, 169, 174, 273
CviQI GTAC 2 cut(s) 52, 145
DdeI CTNAG 1 cut(s) 60
Eam1104I CTCTTC 1 cut(s) 227
EarI CTCTTC 1 cut(s) 227
Eco147I AGGCCT 1 cut(s) 78
Eco47I GGWCC 1 cut(s) 209
EcoO109I RGGNCCY 1 cut(s) 209
FaeI CATG 1 cut(s) 98
FaiI YATR 4 cut(s) 45, 96, 222, 270
FatI CATG 1 cut(s) 94
FokI GGATG 1 cut(s) 26
FspBI CTAG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 78
Hin1II CATG 1 cut(s) 98
HinfI GANTC 1 cut(s) 118
Hpy188III TCNNGA 2 cut(s) 95, 193
Hpy99I CGWCG 1 cut(s) 126
HpyAV CCTTC 2 cut(s) 68, 239
HpyCH4V TGCA 1 cut(s) 9
HpyF3I CTNAG 1 cut(s) 60
Hsp92II CATG 1 cut(s) 98
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 5 cut(s) 19, 50, 72, 124, 206
MaeI CTAG 1 cut(s) 171
MboII GAAGA 3 cut(s) 241, 244, 275
MluCI AATT 1 cut(s) 150
MnlI CCTC 2 cut(s) 42, 78
MseI TTAA 1 cut(s) 138
Mva1269I GAATGC 1 cut(s) 104
NlaIII CATG 1 cut(s) 98
NlaIV GGNNCC 1 cut(s) 191
PagI TCATGA 1 cut(s) 94
PceI AGGCCT 1 cut(s) 78
PctI GAATGC 1 cut(s) 104
PfeI GAWTC 1 cut(s) 118
PpuMI RGGWCCY 1 cut(s) 209
Psp5II RGGWCCY 1 cut(s) 209
PspN4I GGNNCC 1 cut(s) 191
PspPI GGNCC 1 cut(s) 209
PspPPI RGGWCCY 1 cut(s) 209
RsaI GTAC 2 cut(s) 53, 146
RsaNI GTAC 2 cut(s) 52, 145
SaqAI TTAA 1 cut(s) 138
Sau96I GGNCC 1 cut(s) 209
SetI ASST 6 cut(s) 53, 61, 69, 135, 214, 275
SfcI CTRYAG 1 cut(s) 220
SinI GGWCC 1 cut(s) 209
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 1 cut(s) 150
SseBI AGGCCT 1 cut(s) 78
SspMI CTAG 1 cut(s) 171
StuI AGGCCT 1 cut(s) 78
TasI AATT 1 cut(s) 150
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspDTI ATGAA 1 cut(s) 111
TspGWI ACGGA 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 209
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.