Rh3AG310800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
39127599 .. 39128807
1209 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG310800.1

Sequence Viewer

Length: 168 bp
ATGATGCTTCTCACTCCCCTAGAAACTCCACTTTTCCCTTCATCAGATGGAAGTGAATCTCAGCCAACCTTAGCTGCTGCAAGAAGCAGTGCTTTAAATAGATCAACTTCCTCAGCTAAGCCTTTAAGGATGCGGTTCATGATGTGTCTCAACATATGGAAGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.13

Weight (kDa)

10.79

Isoelectric Point (pI)

74.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 133
AluBI AGCT 2 cut(s) 74, 116
AluI AGCT 2 cut(s) 74, 116
Alw26I GTCTC 1 cut(s) 152
ApeKI GCWGC 2 cut(s) 74, 77
BbvCI CCTCAGC 1 cut(s) 112
BbvI GCAGC 2 cut(s) 61, 64
BccI CCATC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 152
BfaI CTAG 1 cut(s) 20
BisI GCNGC 2 cut(s) 75, 78
BlpI GCTNAGC 1 cut(s) 117
BlsI GCNGC 2 cut(s) 76, 79
BmsI GCATC 1 cut(s) 120
Bpu10I CCTNAGC 2 cut(s) 70, 112
Bpu1102I GCTNAGC 1 cut(s) 117
BseGI GGATG 1 cut(s) 135
BseMII CTCAG 2 cut(s) 74, 126
BseXI GCAGC 2 cut(s) 61, 64
BsmAI GTCTC 1 cut(s) 152
Bsp143I GATC 1 cut(s) 101
Bsp1720I GCTNAGC 1 cut(s) 117
BspACI CCGC 1 cut(s) 133
BspCNI CTCAG 2 cut(s) 73, 125
BspHI TCATGA 1 cut(s) 138
BssMI GATC 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 155
BstDEI CTNAG 4 cut(s) 60, 70, 112, 117
BstF5I GGATG 1 cut(s) 135
BstKTI GATC 1 cut(s) 104
BstMAI GTCTC 1 cut(s) 152
BstMBI GATC 1 cut(s) 101
BstV1I GCAGC 2 cut(s) 61, 64
BtsCI GGATG 1 cut(s) 135
BtsI GCAGTG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 94
CciI TCATGA 1 cut(s) 138
CviAII CATG 1 cut(s) 139
CviJI RGCY 4 cut(s) 64, 74, 116, 121
CviKI_1 RGCY 4 cut(s) 64, 74, 116, 121
DdeI CTNAG 4 cut(s) 60, 70, 112, 117
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
DraI TTTAAA 1 cut(s) 96
Eam1104I CTCTTC 1 cut(s) 155
EarI CTCTTC 1 cut(s) 155
FaeI CATG 1 cut(s) 142
FaiI YATR 3 cut(s) 140, 155, 157
FalI AAGNNNNNCTT 2 cut(s) 76, 108
FatI CATG 1 cut(s) 138
FauNDI CATATG 1 cut(s) 155
Fnu4HI GCNGC 2 cut(s) 75, 78
FokI GGATG 1 cut(s) 142
Fsp4HI GCNGC 2 cut(s) 75, 78
FspBI CTAG 1 cut(s) 20
GluI GCNGC 2 cut(s) 75, 78
Hin1II CATG 1 cut(s) 142
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 80
HpyF3I CTNAG 4 cut(s) 60, 70, 112, 117
Hsp92II CATG 1 cut(s) 142
Kzo9I GATC 1 cut(s) 101
Lsp1109I GCAGC 2 cut(s) 61, 64
LweI GCATC 1 cut(s) 120
MaeI CTAG 1 cut(s) 20
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MnlI CCTC 2 cut(s) 121, 156
MseI TTAA 2 cut(s) 95, 125
NdeI CATATG 1 cut(s) 155
NdeII GATC 1 cut(s) 101
NlaIII CATG 1 cut(s) 142
PagI TCATGA 1 cut(s) 138
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 2 cut(s) 76, 79
SaqAI TTAA 2 cut(s) 95, 125
SatI GCNGC 2 cut(s) 75, 78
Sau3AI GATC 1 cut(s) 101
SetI ASST 4 cut(s) 71, 76, 118, 167
SfaNI GCATC 1 cut(s) 120
SgeI CNNG 3 cut(s) 32, 93, 151
SsiI CCGC 1 cut(s) 133
SspMI CTAG 1 cut(s) 20
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 95, 125
Tru9I TTAA 2 cut(s) 95, 125
TscAI CASTG 1 cut(s) 94
TseI GCWGC 2 cut(s) 74, 77
TspDTI ATGAA 2 cut(s) 30, 127
TspRI CASTG 1 cut(s) 94
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.