Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006010.1

Orthogroup ID

OG0005555

Physical Location & Seq

Genomic Coordinates Forward (+)

45604 .. 45970

Gene Structure 367 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006010.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 309 bp

atgtcacccaccaaattgagcttcgatgaacttagtggtcaatgggttgacctggcttcggggattaatttttgggtatctcaattctgttccctctcttgtcaaacccgattcaacacccctttgagtgtgacccggctttttgtggttggagttgtggtagaggagctttttaggaatggcaaaggagtaatggataatggcaagtacgtgaggtccagagttgagcaggttgaagcccttgagaggctttatagtgaatgccccaaacctagttcgattcgccgccaacaactcattaagaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox MEKHLA START

Protein Analysis

102

Amino Acids

11.65

Weight (kDa)

9.22

Isoelectric Point (pI)

40.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005555)

Species	Orthologous Gene IDs
pyrus_communis	pycom110g00030
rosa_chinensis	RchiOBHm_Chr1g0322901 RchiOBHm_Chr2g0111751 RchiOBHm_Chr2g0164871 RchiOBHm_Chr5g0028331 RchiOBHm_Chr6g0258951
rosa_multiflora	Rmu_sc0006010.1_g000013
rosa_roxburghii	Rroxscaffold_1G00030400
rosa_rugosa	Rorug06G0249500 Rorug06G0249500 Rorug06G0249600
rosa_samantha	Rh1BG244300 Rh2CG232400 Rh2CG295900 Rh2DG332800 Rh3AG253200 Rh3AG309200 Rh3AG310800 Rh3BG355500 Rh3CG342500 Rh4AG132400 Rh5AG356000 Rh5BG260900 Rh5BG263300 Rh5BG491200 Rh5CG515000 Rh5DG386200 Rh6BG167200 Rh6BG273500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	220
AciI	CCGC	1 cut(s)	286
AfaI	GTAC	1 cut(s)	209
AfiI	CCNNNNNNNGG	2 cut(s)	58, 246
AgsI	TTSAA	2 cut(s)	115, 236
AjnI	CCWGG	1 cut(s)	51
AjuI	GAANNNNNNNTTGG	1 cut(s)	37
AluBI	AGCT	2 cut(s)	21, 169
AluI	AGCT	2 cut(s)	21, 169
AseI	ATTAAT	1 cut(s)	66
AspS9I	GGNCC	1 cut(s)	216
AsuC2I	CCSGG	1 cut(s)	136
AvaII	GGWCC	1 cut(s)	216
BciT130I	CCWGG	1 cut(s)	53
BcnI	CCSGG	1 cut(s)	136
BfaI	CTAG	1 cut(s)	273
BfuAI	ACCTGC	1 cut(s)	220
BisI	GCNGC	1 cut(s)	286
BlsI	GCNGC	1 cut(s)	287
Bme1390I	CCNGG	2 cut(s)	53, 136
Bme18I	GGWCC	1 cut(s)	216
BmgT120I	GGNCC	1 cut(s)	216
BmrFI	CCNGG	2 cut(s)	53, 136
BpuEI	CTTGAG	1 cut(s)	263
BpuMI	CCSGG	1 cut(s)	136
BsaAI	YACGTR	1 cut(s)	211
BsaXI	ACNNNNNCTCC	2 cut(s)	144, 174
Bsc4I	CCNNNNNNNGG	2 cut(s)	58, 246
BseBI	CCWGG	1 cut(s)	53
BseLI	CCNNNNNNNGG	2 cut(s)	58, 246
BseRI	GAGGAG	1 cut(s)	179
BsiSI	CCGG	1 cut(s)	136
BslI	CCNNNNNNNGG	2 cut(s)	58, 246
BsmI	GAATGC	1 cut(s)	266
BspACI	CCGC	1 cut(s)	286
BspMI	ACCTGC	1 cut(s)	220
Bst2UI	CCWGG	1 cut(s)	53
BstBAI	YACGTR	1 cut(s)	211
BstDEI	CTNAG	1 cut(s)	32
BstNI	CCWGG	1 cut(s)	53
BstSCI	CCNGG	2 cut(s)	51, 134
BveI	ACCTGC	1 cut(s)	220
Cfr13I	GGNCC	1 cut(s)	216
Csp6I	GTAC	1 cut(s)	208
CviJI	RGCY	6 cut(s)	21, 56, 139, 169, 239, 250
CviKI_1	RGCY	6 cut(s)	21, 56, 139, 169, 239, 250
CviQI	GTAC	1 cut(s)	208
DdeI	CTNAG	1 cut(s)	32
Eco47I	GGWCC	1 cut(s)	216
EcoRII	CCWGG	1 cut(s)	51
FaiI	YATR	1 cut(s)	255
Fnu4HI	GCNGC	1 cut(s)	286
Fsp4HI	GCNGC	1 cut(s)	286
FspBI	CTAG	1 cut(s)	273
GluI	GCNGC	1 cut(s)	286
HapII	CCGG	1 cut(s)	136
HincII	GTYRAC	1 cut(s)	49
HindII	GTYRAC	1 cut(s)	49
HinfI	GANTC	2 cut(s)	111, 280
HpaII	CCGG	1 cut(s)	136
Hpy166II	GTNNAC	1 cut(s)	49
Hpy188III	TCNNGA	1 cut(s)	219
Hpy8I	GTNNAC	1 cut(s)	49
HpyCH4IV	ACGT	1 cut(s)	210
HpyF3I	CTNAG	1 cut(s)	32
HpySE526I	ACGT	1 cut(s)	210
LmnI	GCTCC	1 cut(s)	166
LpnPI	CCDG	5 cut(s)	38, 65, 149, 215, 232
MaeI	CTAG	1 cut(s)	273
MaeII	ACGT	1 cut(s)	210
MaeIII	GTNAC	2 cut(s)	3, 130
MluCI	AATT	3 cut(s)	14, 67, 83
MmeI	TCCRAC	1 cut(s)	130
MnlI	CCTC	4 cut(s)	104, 157, 207, 240
MseI	TTAA	2 cut(s)	66, 300
MspI	CCGG	1 cut(s)	136
MspR9I	CCNGG	2 cut(s)	53, 136
Mva1269I	GAATGC	1 cut(s)	266
MvaI	CCWGG	1 cut(s)	53
NciI	CCSGG	1 cut(s)	136
NmuCI	GTSAC	2 cut(s)	3, 130
PctI	GAATGC	1 cut(s)	266
PfeI	GAWTC	2 cut(s)	111, 280
PkrI	GCNGC	1 cut(s)	287
Ppu21I	YACGTR	1 cut(s)	211
PshBI	ATTAAT	1 cut(s)	66
Psp6I	CCWGG	1 cut(s)	51
PspGI	CCWGG	1 cut(s)	51
PspPI	GGNCC	1 cut(s)	216
RsaI	GTAC	1 cut(s)	209
RsaNI	GTAC	1 cut(s)	208
SaqAI	TTAA	2 cut(s)	66, 300
SatI	GCNGC	1 cut(s)	286
Sau96I	GGNCC	1 cut(s)	216
ScrFI	CCNGG	2 cut(s)	53, 136
SetI	ASST	7 cut(s)	23, 54, 171, 213, 218, 234, 274
SinI	GGWCC	1 cut(s)	216
SmlI	CTYRAG	1 cut(s)	242
SmoI	CTYRAG	1 cut(s)	242
Sse9I	AATT	3 cut(s)	14, 67, 83
SsiI	CCGC	1 cut(s)	286
SspMI	CTAG	1 cut(s)	273
StyD4I	CCNGG	2 cut(s)	51, 134
TaiI	ACGT	1 cut(s)	213
TaqI	TCGA	2 cut(s)	24, 278
TasI	AATT	3 cut(s)	14, 67, 83
TauI	GCSGC	1 cut(s)	288
TfiI	GAWTC	2 cut(s)	111, 280
Tru1I	TTAA	2 cut(s)	66, 300
Tru9I	TTAA	2 cut(s)	66, 300
TseFI	GTSAC	2 cut(s)	3, 130
Tsp45I	GTSAC	2 cut(s)	3, 130
TspDTI	ATGAA	1 cut(s)	42
VpaK11BI	GGWCC	1 cut(s)	216
VspI	ATTAAT	1 cut(s)	66
XspI	CTAG	1 cut(s)	273

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.