Rh5BG260900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
32672868 .. 32680638
7771 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG260900.1

Sequence Viewer

Length: 231 bp
ATGGTGAAGGTATGGGCTGAGAAAGAAAATAGGAATCTGGACAGGCTTCTCACTCCCCCAGAAACTCCACTTTTCCCTTCATCAGATGGAAGTGAATCTCAACCAACCTTAGCTGCTGCAAGAAGCAGTGCTTTAAATAGATCAACTTCCTCAGCCAAGCCTTCAAGGAAGCTGAATGCCATAGCTTGTGCCTCAGAAACTTGTGCAAGAATTCCAAGATGCGGTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.13

Weight (kDa)

9.41

Isoelectric Point (pI)

56.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 222
AcsI RAATTY 1 cut(s) 210
AfiI CCNNNNNNNGG 1 cut(s) 221
AgsI TTSAA 1 cut(s) 165
AjuI GAANNNNNNNTTGG 1 cut(s) 208
AluBI AGCT 3 cut(s) 113, 172, 185
AluI AGCT 3 cut(s) 113, 172, 185
ApeKI GCWGC 2 cut(s) 113, 116
ApoI RAATTY 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 16
BbvCI CCTCAGC 1 cut(s) 151
BbvI GCAGC 2 cut(s) 100, 103
BccI CCATC 1 cut(s) 80
BisI GCNGC 2 cut(s) 114, 117
BlsI GCNGC 2 cut(s) 115, 118
BmsI GCATC 1 cut(s) 209
Bpu10I CCTNAGC 2 cut(s) 109, 151
Bsc4I CCNNNNNNNGG 1 cut(s) 221
BseLI CCNNNNNNNGG 1 cut(s) 221
BseMII CTCAG 3 cut(s) 9, 165, 207
BseXI GCAGC 2 cut(s) 100, 103
BslI CCNNNNNNNGG 1 cut(s) 221
BsmI GAATGC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 140
BspACI CCGC 1 cut(s) 222
BspCNI CTCAG 3 cut(s) 10, 164, 206
BspHI TCATGA 1 cut(s) 227
BssMI GATC 1 cut(s) 140
BstDEI CTNAG 4 cut(s) 18, 109, 151, 193
BstKTI GATC 1 cut(s) 143
BstMBI GATC 1 cut(s) 140
BstV1I GCAGC 2 cut(s) 100, 103
BtsI GCAGTG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 133
CciI TCATGA 1 cut(s) 227
CviAII CATG 1 cut(s) 228
CviJI RGCY 7 cut(s) 17, 46, 113, 155, 160, 172, 185
CviKI_1 RGCY 7 cut(s) 17, 46, 113, 155, 160, 172, 185
DdeI CTNAG 4 cut(s) 18, 109, 151, 193
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
DraI TTTAAA 1 cut(s) 135
EcoRI GAATTC 1 cut(s) 210
FaeI CATG 1 cut(s) 231
FaiI YATR 3 cut(s) 13, 182, 229
FalI AAGNNNNNCTT 2 cut(s) 115, 147
FatI CATG 1 cut(s) 227
Fnu4HI GCNGC 2 cut(s) 114, 117
Fsp4HI GCNGC 2 cut(s) 114, 117
GluI GCNGC 2 cut(s) 114, 117
Hin1II CATG 1 cut(s) 231
HinfI GANTC 2 cut(s) 34, 95
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 85, 196
Hpy188III TCNNGA 2 cut(s) 38, 228
HpyAV CCTTC 2 cut(s) 87, 171
HpyCH4V TGCA 2 cut(s) 119, 206
HpyF3I CTNAG 4 cut(s) 18, 109, 151, 193
Hsp92II CATG 1 cut(s) 231
Kzo9I GATC 1 cut(s) 140
LpnPI CCDG 3 cut(s) 23, 28, 72
Lsp1109I GCAGC 2 cut(s) 100, 103
LweI GCATC 1 cut(s) 209
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MluCI AATT 1 cut(s) 210
MnlI CCTC 2 cut(s) 160, 202
MseI TTAA 1 cut(s) 134
Mva1269I GAATGC 1 cut(s) 181
NdeII GATC 1 cut(s) 140
NlaIII CATG 1 cut(s) 231
PagI TCATGA 1 cut(s) 227
PctI GAATGC 1 cut(s) 181
PfeI GAWTC 2 cut(s) 34, 95
PkrI GCNGC 2 cut(s) 115, 118
SaqAI TTAA 1 cut(s) 134
SatI GCNGC 2 cut(s) 114, 117
Sau3AI GATC 1 cut(s) 140
SetI ASST 5 cut(s) 12, 110, 115, 174, 187
SfaNI GCATC 1 cut(s) 209
SgeI CNNG 9 cut(s) 50, 55, 71, 132, 169, 177, 198, 213, 219
Sse9I AATT 1 cut(s) 210
SsiI CCGC 1 cut(s) 222
TasI AATT 1 cut(s) 210
TfiI GAWTC 2 cut(s) 34, 95
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 1 cut(s) 133
TseI GCWGC 2 cut(s) 113, 116
TspDTI ATGAA 2 cut(s) 69, 216
TspRI CASTG 1 cut(s) 133
XapI RAATTY 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.