RchiOBHm_Chr6g0258951

Homeobox-leucine zipper protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0005555
Physical Location & Seq
Reverse (-)
14315375 .. 14318005
2631 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23220

Sequence Viewer

Length: 225 bp
ATGGCTATGTCCTGCACGGATGGTAAAGGAGTAATGGATAATGGCAAGTATGTGAGGTACAAACCTAAGCAGGTTGTTGAAGCCCTTGAGAGCCTTTATCATGAATGCTCCAAACCTAGTTCGATTCGTCGCCAACAGCTCATTAAGGAGTACCCAATTCTCTCTAACATTGAGCCTAGCCAAATCAAAGTTTGGTTCCAGAACAGAAGATGCAAAGAAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Homeobox MEKHLA START

Protein Analysis

74

Amino Acids

8.68

Weight (kDa)

9.3

Isoelectric Point (pI)

76.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Homeodomain PF00046 19 - 73 1.3e-12 Homeodomain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 61
AfaI GTAC 2 cut(s) 59, 152
AgsI TTSAA 1 cut(s) 80
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
BccI CCATC 1 cut(s) 14
BfaI CTAG 2 cut(s) 117, 177
BfuAI ACCTGC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 197
BmsI GCATC 1 cut(s) 200
Bpu10I CCTNAGC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 107
BseGI GGATG 1 cut(s) 25
BsmI GAATGC 1 cut(s) 110
BspHI TCATGA 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 197
BspMI ACCTGC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 25
BtsCI GGATG 1 cut(s) 25
BveI ACCTGC 1 cut(s) 61
CciI TCATGA 1 cut(s) 100
Csp6I GTAC 2 cut(s) 58, 151
CviAII CATG 1 cut(s) 101
CviJI RGCY 6 cut(s) 5, 83, 93, 139, 175, 180
CviKI_1 RGCY 6 cut(s) 5, 83, 93, 139, 175, 180
CviQI GTAC 2 cut(s) 58, 151
DdeI CTNAG 1 cut(s) 66
FaeI CATG 1 cut(s) 104
FaiI YATR 3 cut(s) 8, 51, 102
FatI CATG 1 cut(s) 100
FokI GGATG 1 cut(s) 32
FspBI CTAG 2 cut(s) 117, 177
Hin1II CATG 1 cut(s) 104
HinfI GANTC 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 101, 199
Hpy99I CGWCG 1 cut(s) 132
HpyCH4V TGCA 2 cut(s) 15, 213
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 1 cut(s) 104
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 3 cut(s) 25, 56, 212
LweI GCATC 1 cut(s) 200
MaeI CTAG 2 cut(s) 117, 177
MboII GAAGA 1 cut(s) 219
MluCI AATT 1 cut(s) 156
MnlI CCTC 1 cut(s) 48
MseI TTAA 1 cut(s) 144
Mva1269I GAATGC 1 cut(s) 110
NlaIII CATG 1 cut(s) 104
NlaIV GGNNCC 1 cut(s) 197
PagI TCATGA 1 cut(s) 100
PctI GAATGC 1 cut(s) 110
PfeI GAWTC 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 197
RsaI GTAC 2 cut(s) 59, 152
RsaNI GTAC 2 cut(s) 58, 151
SaqAI TTAA 1 cut(s) 144
SetI ASST 5 cut(s) 59, 67, 75, 118, 141
SfaNI GCATC 1 cut(s) 200
SgeI CNNG 9 cut(s) 24, 28, 58, 83, 98, 113, 129, 189, 211
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 1 cut(s) 156
SspMI CTAG 2 cut(s) 117, 177
TaqI TCGA 1 cut(s) 122
TasI AATT 1 cut(s) 156
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TspDTI ATGAA 1 cut(s) 117
TspGWI ACGGA 1 cut(s) 32
XspI CTAG 2 cut(s) 117, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.