RchiOBHm_Chr1g0334601

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
26739333 .. 26740419
1087 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56332

Sequence Viewer

Length: 165 bp
ATGGTTTCTCTTCTCTTATTTTTCGTCTTCTCCTCTGATTTTCTTCAGATTGGACAAGGTGGTTTTGGGGTTGTTTACTATTCCAAGCTGACAAGTGAGGACAATACTAAAATTGTGACAGCTTCTGGTGATCAAACTGTAACTGTCCACTTTGAGAGAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.97

Weight (kDa)

4.83

Isoelectric Point (pI)

25.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 29
AluBI AGCT 2 cut(s) 88, 122
AluI AGCT 2 cut(s) 88, 122
AlwNI CAGNNNCTG 1 cut(s) 125
AsuHPI GGTGA 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 19
BclI TGATCA 1 cut(s) 130
BpiI GAAGAC 1 cut(s) 19
BseRI GAGGAG 1 cut(s) 22
Bsp143I GATC 1 cut(s) 130
BssMI GATC 1 cut(s) 130
Bst4CI ACNGT 2 cut(s) 139, 145
Bst6I CTCTTC 1 cut(s) 15
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstV2I GAAGAC 1 cut(s) 19
CaiI CAGNNNCTG 1 cut(s) 125
CviJI RGCY 2 cut(s) 88, 122
CviKI_1 RGCY 2 cut(s) 88, 122
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
Eco57I CTGAAG 1 cut(s) 29
FbaI TGATCA 1 cut(s) 130
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 2 cut(s) 76, 148
Hpy188I TCNGA 2 cut(s) 37, 48
Hpy8I GTNNAC 2 cut(s) 76, 148
HpyCH4III ACNGT 2 cut(s) 139, 145
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 1 cut(s) 111
MaeIII GTNAC 2 cut(s) 115, 139
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 2 cut(s) 19, 35
MluCI AATT 1 cut(s) 111
MnlI CCTC 2 cut(s) 43, 91
NdeII GATC 1 cut(s) 130
NmuCI GTSAC 1 cut(s) 115
PstNI CAGNNNCTG 1 cut(s) 125
Sau3AI GATC 1 cut(s) 130
SetI ASST 3 cut(s) 61, 90, 124
SgeI CNNG 4 cut(s) 68, 97, 105, 138
Sse9I AATT 1 cut(s) 111
TaaI ACNGT 2 cut(s) 139, 145
TasI AATT 1 cut(s) 111
TseFI GTSAC 1 cut(s) 115
Tsp45I GTSAC 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.