Rh6BG125800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
19572890 .. 19574497
1608 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG125800.1

Sequence Viewer

Length: 207 bp
ATGGGAGAAGATCATGTGTACACAAAAGATCAGAGGCTCCTTGCATTCTCTGGCTCACACCCACTTAACAGTAATCGGCTCAGGTTTAACATTGCACCAGACTTGATGAATCAAGCAAAAGATTATTTGAACAGAACTATGTTTGTTATATTGTTGGCTAGATACATTTTGAATGAGAACCTCTCCTATCTGCCGCAAAGAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.05

Weight (kDa)

9.69

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 194
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 2 cut(s) 130, 172
BfaI CTAG 1 cut(s) 159
BisI GCNGC 1 cut(s) 194
BlsI GCNGC 1 cut(s) 195
BmiI GGNNCC 1 cut(s) 38
BplI GAGNNNNNCTC 2 cut(s) 167, 199
Bpu10I CCTNAGC 1 cut(s) 80
Bse3DI GCAATG 1 cut(s) 90
BseMI GCAATG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 94
BsmI GAATGC 1 cut(s) 44
Bsp1407I TGTACA 1 cut(s) 18
Bsp143I GATC 2 cut(s) 10, 28
BspACI CCGC 1 cut(s) 194
BspCNI CTCAG 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 38
BsrDI GCAATG 1 cut(s) 90
BsrGI TGTACA 1 cut(s) 18
BssMI GATC 2 cut(s) 10, 28
Bst4CI ACNGT 1 cut(s) 71
BstAUI TGTACA 1 cut(s) 18
BstDEI CTNAG 1 cut(s) 80
BstKTI GATC 2 cut(s) 13, 31
BstMBI GATC 2 cut(s) 10, 28
Csp6I GTAC 1 cut(s) 19
CviAII CATG 1 cut(s) 14
CviJI RGCY 4 cut(s) 37, 54, 79, 158
CviKI_1 RGCY 4 cut(s) 37, 54, 79, 158
CviQI GTAC 1 cut(s) 19
DdeI CTNAG 1 cut(s) 80
DpnI GATC 2 cut(s) 12, 30
DpnII GATC 2 cut(s) 10, 28
FaeI CATG 1 cut(s) 17
FaiI YATR 3 cut(s) 15, 140, 149
FatI CATG 1 cut(s) 13
Fnu4HI GCNGC 1 cut(s) 194
Fsp4HI GCNGC 1 cut(s) 194
FspBI CTAG 1 cut(s) 159
GluI GCNGC 1 cut(s) 194
Hin1II CATG 1 cut(s) 17
HinfI GANTC 1 cut(s) 109
Hpy166II GTNNAC 2 cut(s) 19, 21
Hpy188I TCNGA 1 cut(s) 33
Hpy8I GTNNAC 2 cut(s) 19, 21
HpyAV CCTTC 1 cut(s) 195
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4V TGCA 2 cut(s) 44, 95
HpyF3I CTNAG 1 cut(s) 80
Hsp92II CATG 1 cut(s) 17
Kzo9I GATC 2 cut(s) 10, 28
LmnI GCTCC 1 cut(s) 42
LpnPI CCDG 3 cut(s) 36, 67, 111
MaeI CTAG 1 cut(s) 159
MalI GATC 2 cut(s) 12, 30
MboI GATC 2 cut(s) 10, 28
MboII GAAGA 1 cut(s) 20
MnlI CCTC 2 cut(s) 27, 191
MseI TTAA 2 cut(s) 66, 87
Mva1269I GAATGC 1 cut(s) 44
NdeII GATC 2 cut(s) 10, 28
NlaIII CATG 1 cut(s) 17
NlaIV GGNNCC 1 cut(s) 38
PctI GAATGC 1 cut(s) 44
PfeI GAWTC 1 cut(s) 109
PkrI GCNGC 1 cut(s) 195
PspN4I GGNNCC 1 cut(s) 38
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SaqAI TTAA 2 cut(s) 66, 87
SatI GCNGC 1 cut(s) 194
Sau3AI GATC 2 cut(s) 10, 28
SetI ASST 3 cut(s) 86, 183, 206
SgeI CNNG 8 cut(s) 26, 53, 63, 94, 110, 115, 125, 171
SsiI CCGC 1 cut(s) 194
SspMI CTAG 1 cut(s) 159
TaaI ACNGT 1 cut(s) 71
TatI WGTACW 1 cut(s) 18
TauI GCSGC 1 cut(s) 196
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 2 cut(s) 66, 87
Tru9I TTAA 2 cut(s) 66, 87
TspDTI ATGAA 1 cut(s) 122
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.