Rorug06G0151100

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
21634269 .. 21634478
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0151100.1

Sequence Viewer

Length: 210 bp
ATGGAAGATCTTGATTCTACCATTCAGTCCACTCTGGTTCAACAATCTGACTCAAGCTATGCTAGTACGTTAAAAAACTCAGTTGATCGATATAGGCAGACCATGAGGGAGGATTTTGAATTCACTGATAAGGATTGTAGCATGGCCAAAATGTCTCATTCTCGGACAAGGTACAGAATAAACTTGACTTTGATTGGCGTTGTGTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.01

Weight (kDa)

5.65

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 144
AcsI RAATTY 1 cut(s) 119
AfaI GTAC 2 cut(s) 67, 173
AgsI TTSAA 2 cut(s) 41, 119
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
Alw26I GTCTC 1 cut(s) 159
AoxI GGCC 1 cut(s) 144
ApoI RAATTY 1 cut(s) 119
BalI TGGCCA 1 cut(s) 146
BcoDI GTCTC 1 cut(s) 159
BfaI CTAG 1 cut(s) 63
BglII AGATCT 1 cut(s) 7
BpuEI CTTGAG 1 cut(s) 37
Bsa29I ATCGAT 1 cut(s) 88
BseCI ATCGAT 1 cut(s) 88
BseMII CTCAG 1 cut(s) 93
BshFI GGCC 1 cut(s) 146
BshVI ATCGAT 1 cut(s) 88
BsmAI GTCTC 1 cut(s) 159
BsnI GGCC 1 cut(s) 146
Bsp143I GATC 2 cut(s) 7, 85
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 92
BspDI ATCGAT 1 cut(s) 88
BssMI GATC 2 cut(s) 7, 85
BstDEI CTNAG 1 cut(s) 79
BstKTI GATC 2 cut(s) 10, 88
BstMAI GTCTC 1 cut(s) 159
BstMBI GATC 2 cut(s) 7, 85
BstX2I RGATCY 1 cut(s) 7
BstYI RGATCY 1 cut(s) 7
Bsu15I ATCGAT 1 cut(s) 88
BsuRI GGCC 1 cut(s) 146
BsuTUI ATCGAT 1 cut(s) 88
BtsIMutI CAGTG 1 cut(s) 123
ClaI ATCGAT 1 cut(s) 88
Csp6I GTAC 2 cut(s) 66, 172
CviAII CATG 2 cut(s) 103, 142
CviJI RGCY 2 cut(s) 57, 146
CviKI_1 RGCY 2 cut(s) 57, 146
CviQI GTAC 2 cut(s) 66, 172
DdeI CTNAG 1 cut(s) 79
DpnI GATC 2 cut(s) 9, 87
DpnII GATC 2 cut(s) 7, 85
EaeI YGGCCR 1 cut(s) 144
EcoRI GAATTC 1 cut(s) 119
FaeI CATG 2 cut(s) 106, 145
FaiI YATR 4 cut(s) 60, 93, 104, 143
FatI CATG 2 cut(s) 102, 141
FspBI CTAG 1 cut(s) 63
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 2 cut(s) 106, 145
HinfI GANTC 2 cut(s) 14, 50
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 2 cut(s) 49, 165
Hpy188III TCNNGA 1 cut(s) 11
Hpy8I GTNNAC 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 79
HpySE526I ACGT 1 cut(s) 68
Hsp92II CATG 2 cut(s) 106, 145
Kzo9I GATC 2 cut(s) 7, 85
LpnPI CCDG 1 cut(s) 20
MaeI CTAG 1 cut(s) 63
MaeII ACGT 1 cut(s) 68
MalI GATC 2 cut(s) 9, 87
MboI GATC 2 cut(s) 7, 85
MboII GAAGA 1 cut(s) 17
MflI RGATCY 1 cut(s) 7
MlsI TGGCCA 1 cut(s) 146
MluCI AATT 1 cut(s) 119
MluNI TGGCCA 1 cut(s) 146
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 2 cut(s) 99, 103
Mox20I TGGCCA 1 cut(s) 146
MscI TGGCCA 1 cut(s) 146
MseI TTAA 1 cut(s) 71
Msp20I TGGCCA 1 cut(s) 146
NdeII GATC 2 cut(s) 7, 85
NlaIII CATG 2 cut(s) 106, 145
PfeI GAWTC 1 cut(s) 14
PleI GAGTC 1 cut(s) 44
PpsI GAGTC 1 cut(s) 44
PsuI RGATCY 1 cut(s) 7
RsaI GTAC 2 cut(s) 67, 173
RsaNI GTAC 2 cut(s) 66, 172
SaqAI TTAA 1 cut(s) 71
Sau3AI GATC 2 cut(s) 7, 85
SchI GAGTC 1 cut(s) 44
SetI ASST 3 cut(s) 59, 71, 173
SgeI CNNG 9 cut(s) 23, 47, 66, 75, 115, 154, 174, 180, 196
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
Sse9I AATT 1 cut(s) 119
SspMI CTAG 1 cut(s) 63
TaiI ACGT 1 cut(s) 71
TaqI TCGA 1 cut(s) 88
TasI AATT 1 cut(s) 119
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TscAI CASTG 1 cut(s) 130
TspRI CASTG 1 cut(s) 130
XapI RAATTY 1 cut(s) 119
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.