Rh4CG029600

Type I inositol 1,4,5-trisphosphate 5-phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
5906106 .. 5910068
3963 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG029600.1

Sequence Viewer

Length: 157 bp
ATGCAGAAGCATATGATCATGGAGATTCTTTCAAGCCAACTAATGGCTGTCAAAGCACAATCTGATCCAGTGCTTGACAGTCAATCTATAAGTGGTAGTGGGGCTCAAATACCTGTGGGTCGAGATGTTCTGTCATTTCGATTCTGTATCCAAGCAG

Protein Analysis

52

Amino Acids

5.65

Weight (kDa)

6.51

Isoelectric Point (pI)

52.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 43
AclWI GGATC 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 43
AgsI TTSAA 1 cut(s) 33
AlwI GGATC 1 cut(s) 59
BanII GRGCYC 1 cut(s) 106
BclI TGATCA 1 cut(s) 15
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 68
BseLI CCNNNNNNNGG 1 cut(s) 43
BseNI ACTGG 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 106
Bsp143I GATC 2 cut(s) 15, 64
BspPI GGATC 1 cut(s) 59
BsrI ACTGG 1 cut(s) 68
BssMI GATC 2 cut(s) 15, 64
Bst4CI ACNGT 1 cut(s) 80
BstKTI GATC 2 cut(s) 18, 67
BstMBI GATC 2 cut(s) 15, 64
BstMWI GCNNNNNNNGC 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 75
CviAII CATG 1 cut(s) 19
CviJI RGCY 3 cut(s) 36, 47, 104
CviKI_1 RGCY 3 cut(s) 36, 47, 104
DpnI GATC 2 cut(s) 17, 66
DpnII GATC 2 cut(s) 15, 64
Eco24I GRGCYC 1 cut(s) 106
EcoT38I GRGCYC 1 cut(s) 106
FaeI CATG 1 cut(s) 22
FaiI YATR 4 cut(s) 12, 14, 20, 89
FatI CATG 1 cut(s) 18
FauNDI CATATG 1 cut(s) 12
FbaI TGATCA 1 cut(s) 15
FriOI GRGCYC 1 cut(s) 106
Hin1II CATG 1 cut(s) 22
HinfI GANTC 2 cut(s) 25, 141
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 122
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Hsp92II CATG 1 cut(s) 22
Ksp22I TGATCA 1 cut(s) 15
Kzo9I GATC 2 cut(s) 15, 64
LpnPI CCDG 2 cut(s) 81, 126
MalI GATC 2 cut(s) 17, 66
MboI GATC 2 cut(s) 15, 64
MhlI GDGCHC 1 cut(s) 106
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeI CATATG 1 cut(s) 12
NdeII GATC 2 cut(s) 15, 64
NlaIII CATG 1 cut(s) 22
PfeI GAWTC 2 cut(s) 25, 141
PflMI CCANNNNNTGG 1 cut(s) 43
Sau3AI GATC 2 cut(s) 15, 64
SduI GDGCHC 1 cut(s) 106
SetI ASST 1 cut(s) 115
SgeI CNNG 6 cut(s) 31, 45, 80, 86, 125, 134
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 2 cut(s) 121, 139
TfiI GAWTC 2 cut(s) 25, 141
TscAI CASTG 1 cut(s) 75
TspRI CASTG 1 cut(s) 75
Van91I CCANNNNNTGG 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.