RchiOBHm_Chr2g0148431

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
66136365 .. 66142080
5716 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51800

Sequence Viewer

Length: 177 bp
ATGTCTTGGGCTGACTTCGATAAGATTGGACAAGGTGGTTTTGGGGCTGTTTACTATGCCGAGCTGACAAGCAAGAGAAAGGGACGAGACGAAACAAAAAGAGAGAGAGAGAGAGAGACAAGAGAACAGGCAAGAACGAAAAGAAGGAGAAGAGAGAGACGGGAAGCTCTTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.99

Weight (kDa)

10.58

Isoelectric Point (pI)

75.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 64, 167
AluI AGCT 2 cut(s) 64, 167
Alw26I GTCTC 3 cut(s) 81, 110, 151
BcoDI GTCTC 3 cut(s) 81, 110, 151
BslFI GGGAC 1 cut(s) 96
BsmAI GTCTC 3 cut(s) 81, 110, 151
BsmBI CGTCTC 2 cut(s) 81, 151
BsmFI GGGAC 1 cut(s) 96
Bst6I CTCTTC 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 174
BstMAI GTCTC 3 cut(s) 81, 110, 151
CviJI RGCY 4 cut(s) 11, 47, 64, 167
CviKI_1 RGCY 4 cut(s) 11, 47, 64, 167
DdeI CTNAG 1 cut(s) 174
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
Esp3I CGTCTC 2 cut(s) 81, 151
FaiI YATR 1 cut(s) 57
FaqI GGGAC 1 cut(s) 96
Hpy166II GTNNAC 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 138
HpyF3I CTNAG 1 cut(s) 174
LpnPI CCDG 1 cut(s) 113
MboII GAAGA 1 cut(s) 162
NmeAIII GCCGAG 1 cut(s) 85
SetI ASST 3 cut(s) 37, 66, 169
TaqI TCGA 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.