RchiOBHm_Chr1g0334631

pentatricopeptide repeat-containing protein At5g06400

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
26742901 .. 26743312
412 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56333

Sequence Viewer

Length: 183 bp
ATGATGATACGTGCAATCTGTGCTGCTGGAAAAGCTGATGTGGCAATGGAATTTTACAAGGAAATACTGGACACCGACAGAAGGCTGAGGTTAGATAGAGGTTTTGCATCTGGAAGCCTCTATCGAACTTCAGTTAATTTGATTATGATGCAGCCCAATTCAAGTTTTTGGAGGAGGAGCTGA

Protein Analysis

60

Amino Acids

6.95

Weight (kDa)

10.0

Isoelectric Point (pI)

43.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 50
AcuI CTGAAG 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 81
AgsI TTSAA 1 cut(s) 162
AluBI AGCT 2 cut(s) 35, 180
AluI AGCT 2 cut(s) 35, 180
ApeKI GCWGC 2 cut(s) 23, 151
ApoI RAATTY 1 cut(s) 50
BbvCI CCTCAGC 1 cut(s) 86
BbvI GCAGC 2 cut(s) 10, 163
BisI GCNGC 2 cut(s) 24, 152
BlsI GCNGC 2 cut(s) 25, 153
BmsI GCATC 2 cut(s) 116, 138
Bpu10I CCTNAGC 1 cut(s) 86
BsaAI YACGTR 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 81
Bse1I ACTGG 1 cut(s) 72
Bse3DI GCAATG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 81
BseMI GCAATG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 77
BseNI ACTGG 1 cut(s) 72
BseXI GCAGC 2 cut(s) 10, 163
BslI CCNNNNNNNGG 1 cut(s) 81
BspCNI CTCAG 1 cut(s) 78
BsrDI GCAATG 1 cut(s) 51
BsrI ACTGG 1 cut(s) 72
BstAPI GCANNNNNTGC 1 cut(s) 20
BstBAI YACGTR 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 86
BstMWI GCNNNNNNNGC 3 cut(s) 20, 32, 41
BstV1I GCAGC 2 cut(s) 10, 163
CviJI RGCY 5 cut(s) 35, 85, 117, 154, 180
CviKI_1 RGCY 5 cut(s) 35, 85, 117, 154, 180
DdeI CTNAG 1 cut(s) 86
Eco57I CTGAAG 1 cut(s) 114
FaiI YATR 1 cut(s) 146
Fnu4HI GCNGC 2 cut(s) 24, 152
Fsp4HI GCNGC 2 cut(s) 24, 152
GluI GCNGC 2 cut(s) 24, 152
Hpy188III TCNNGA 1 cut(s) 111
HpyAV CCTTC 1 cut(s) 75
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 3 cut(s) 14, 107, 151
HpyF10VI GCNNNNNNNGC 3 cut(s) 20, 32, 41
HpyF3I CTNAG 1 cut(s) 86
HpySE526I ACGT 1 cut(s) 10
LmnI GCTCC 1 cut(s) 177
LpnPI CCDG 3 cut(s) 12, 53, 96
Lsp1109I GCAGC 2 cut(s) 10, 163
LweI GCATC 2 cut(s) 116, 138
MaeII ACGT 1 cut(s) 10
MluCI AATT 3 cut(s) 50, 136, 157
MnlI CCTC 5 cut(s) 81, 92, 128, 165, 168
MseI TTAA 1 cut(s) 135
MwoI GCNNNNNNNGC 3 cut(s) 20, 32, 41
PkrI GCNGC 2 cut(s) 25, 153
Ppu21I YACGTR 1 cut(s) 11
SaqAI TTAA 1 cut(s) 135
SatI GCNGC 2 cut(s) 24, 152
SetI ASST 5 cut(s) 13, 37, 92, 103, 182
SfaNI GCATC 2 cut(s) 116, 138
SgeI CNNG 6 cut(s) 23, 39, 70, 80, 123, 174
Sse9I AATT 3 cut(s) 50, 136, 157
TaiI ACGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 124
TasI AATT 3 cut(s) 50, 136, 157
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TseI GCWGC 2 cut(s) 23, 151
XapI RAATTY 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.