RchiOBHm_Chr1g0349621

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
42714470 .. 42726061
11592 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57558

Sequence Viewer

Length: 138 bp
ATGCTTTCGGTCAGCGGAGGCAGCATTCTATCATGGATTGGACATGATTATTTTGTTGTGGATGATAAGACTGCTGCACATCATGAGGCAGTAGGAAACCTATTACTTCAGATGGCTGTCAATTCATATATGTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

4.87

Weight (kDa)

5.16

Isoelectric Point (pI)

35.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 15
AcuI CTGAAG 1 cut(s) 92
ApeKI GCWGC 2 cut(s) 21, 74
BbvI GCAGC 2 cut(s) 33, 61
BccI CCATC 1 cut(s) 106
BisI GCNGC 2 cut(s) 22, 75
BlsI GCNGC 2 cut(s) 23, 76
BseGI GGATG 1 cut(s) 67
BseXI GCAGC 2 cut(s) 33, 61
BsgI GTGCAG 1 cut(s) 60
BsmI GAATGC 1 cut(s) 24
BspACI CCGC 1 cut(s) 15
BspHI TCATGA 2 cut(s) 82, 134
BstF5I GGATG 1 cut(s) 67
BstMWI GCNNNNNNNGC 1 cut(s) 21
BstV1I GCAGC 2 cut(s) 33, 61
BtsCI GGATG 1 cut(s) 67
CciI TCATGA 2 cut(s) 82, 134
CviAII CATG 4 cut(s) 33, 44, 83, 135
CviJI RGCY 1 cut(s) 116
CviKI_1 RGCY 1 cut(s) 116
Eco57I CTGAAG 1 cut(s) 92
FaeI CATG 4 cut(s) 36, 47, 86, 138
FaiI YATR 7 cut(s) 34, 45, 84, 127, 129, 131, 136
FatI CATG 4 cut(s) 32, 43, 82, 134
Fnu4HI GCNGC 2 cut(s) 22, 75
FokI GGATG 1 cut(s) 74
Fsp4HI GCNGC 2 cut(s) 22, 75
FspEI CC 8 cut(s) 3, 19, 24, 44, 71, 78, 98, 113
GluI GCNGC 2 cut(s) 22, 75
Hin1II CATG 4 cut(s) 36, 47, 86, 138
Hpy188I TCNGA 1 cut(s) 111
Hpy188III TCNNGA 2 cut(s) 83, 135
HpyCH4V TGCA 1 cut(s) 77
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
Hsp92II CATG 4 cut(s) 36, 47, 86, 138
Lsp1109I GCAGC 2 cut(s) 33, 61
MluCI AATT 1 cut(s) 121
MnlI CCTC 2 cut(s) 11, 79
MspA1I CMGCKG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 21
NlaIII CATG 4 cut(s) 36, 47, 86, 138
PagI TCATGA 2 cut(s) 82, 134
PctI GAATGC 1 cut(s) 24
PkrI GCNGC 2 cut(s) 23, 76
SatI GCNGC 2 cut(s) 22, 75
SetI ASST 1 cut(s) 102
SgeI CNNG 3 cut(s) 45, 56, 95
Sse9I AATT 1 cut(s) 121
SsiI CCGC 1 cut(s) 15
TasI AATT 1 cut(s) 121
TseI GCWGC 2 cut(s) 21, 74
TspDTI ATGAA 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.