Rh4CG340700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
60025738 .. 60027326
1589 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG340700.1

Sequence Viewer

Length: 210 bp
ATGCTTTCGGCCAGCGGAGGCAGCATTCTATCATGGATTGGACATGATTATTTTGTTGTGGATGATAAGACTGCTGCACATCATGAGGTCACACATTGCAGCTTCAAGCATTCTTCAAATCTTGCATACTCCATGGCTGGATGGACAAAATTTCCACTCTTACACTCTACAAAGCACGAAGCTGACAACCTTTCAGATCAGTTCACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.66

Weight (kDa)

6.1

Isoelectric Point (pI)

11.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 15
AcoI YGGCCR 1 cut(s) 9
AcsI RAATTY 1 cut(s) 149
AgsI TTSAA 2 cut(s) 106, 117
AluBI AGCT 2 cut(s) 102, 182
AluI AGCT 2 cut(s) 102, 182
AoxI GGCC 1 cut(s) 9
ApeKI GCWGC 3 cut(s) 21, 74, 99
ApoI RAATTY 1 cut(s) 149
BbvI GCAGC 3 cut(s) 33, 61, 111
BccI CCATC 1 cut(s) 135
BisI GCNGC 3 cut(s) 22, 75, 100
BlsI GCNGC 3 cut(s) 23, 76, 101
BsaJI CCNNGG 1 cut(s) 132
Bse3DI GCAATG 1 cut(s) 94
BseDI CCNNGG 1 cut(s) 132
BseGI GGATG 2 cut(s) 67, 146
BseMI GCAATG 1 cut(s) 94
BseXI GCAGC 3 cut(s) 33, 61, 111
BsgI GTGCAG 1 cut(s) 60
BshFI GGCC 1 cut(s) 11
BsmI GAATGC 2 cut(s) 24, 109
BsnI GGCC 1 cut(s) 11
Bsp143I GATC 1 cut(s) 196
Bsp19I CCATGG 1 cut(s) 132
BspACI CCGC 1 cut(s) 15
BspANI GGCC 1 cut(s) 11
BspHI TCATGA 1 cut(s) 82
BsrDI GCAATG 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 132
BssMI GATC 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 13
BstDSI CCRYGG 1 cut(s) 132
BstF5I GGATG 2 cut(s) 67, 146
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstMWI GCNNNNNNNGC 1 cut(s) 21
BstV1I GCAGC 3 cut(s) 33, 61, 111
BsuRI GGCC 1 cut(s) 11
BtgI CCRYGG 1 cut(s) 132
BtsCI GGATG 2 cut(s) 67, 146
Cac8I GCNNGC 1 cut(s) 13
CciI TCATGA 1 cut(s) 82
CviAII CATG 5 cut(s) 33, 44, 83, 133, 207
CviJI RGCY 4 cut(s) 11, 102, 137, 182
CviKI_1 RGCY 4 cut(s) 11, 102, 137, 182
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
EaeI YGGCCR 1 cut(s) 9
Eco130I CCWWGG 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 132
ErhI CCWWGG 1 cut(s) 132
FaeI CATG 5 cut(s) 36, 47, 86, 136, 210
FaiI YATR 6 cut(s) 34, 45, 84, 127, 134, 208
FatI CATG 5 cut(s) 32, 43, 82, 132, 206
Fnu4HI GCNGC 3 cut(s) 22, 75, 100
FokI GGATG 2 cut(s) 74, 153
Fsp4HI GCNGC 3 cut(s) 22, 75, 100
GluI GCNGC 3 cut(s) 22, 75, 100
HaeIII GGCC 1 cut(s) 11
Hin1II CATG 5 cut(s) 36, 47, 86, 136, 210
Hpy166II GTNNAC 1 cut(s) 204
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 1 cut(s) 83
Hpy8I GTNNAC 1 cut(s) 204
HpyCH4V TGCA 3 cut(s) 77, 99, 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
Hsp92II CATG 5 cut(s) 36, 47, 86, 136, 210
Kzo9I GATC 1 cut(s) 196
LpnPI CCDG 2 cut(s) 25, 123
Lsp1109I GCAGC 3 cut(s) 33, 61, 111
MaeIII GTNAC 1 cut(s) 88
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 1 cut(s) 105
MluCI AATT 1 cut(s) 149
MnlI CCTC 2 cut(s) 11, 79
MspA1I CMGCKG 1 cut(s) 15
Mva1269I GAATGC 2 cut(s) 24, 109
MwoI GCNNNNNNNGC 1 cut(s) 21
NcoI CCATGG 1 cut(s) 132
NdeII GATC 1 cut(s) 196
NlaIII CATG 5 cut(s) 36, 47, 86, 136, 210
NmuCI GTSAC 1 cut(s) 88
PagI TCATGA 1 cut(s) 82
PctI GAATGC 2 cut(s) 24, 109
PkrI GCNGC 3 cut(s) 23, 76, 101
SatI GCNGC 3 cut(s) 22, 75, 100
Sau3AI GATC 1 cut(s) 196
SetI ASST 4 cut(s) 90, 104, 184, 192
SgeI CNNG 9 cut(s) 24, 45, 56, 95, 118, 134, 145, 150, 188
Sse9I AATT 1 cut(s) 149
SsiI CCGC 1 cut(s) 15
StyI CCWWGG 1 cut(s) 132
TasI AATT 1 cut(s) 149
TseFI GTSAC 1 cut(s) 88
TseI GCWGC 3 cut(s) 21, 74, 99
Tsp45I GTSAC 1 cut(s) 88
XapI RAATTY 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.