RchiOBHm_Chr5g0079771

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
85524327 .. 85525139
813 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35414

Sequence Viewer

Length: 165 bp
ATGCTCTTTCTTTATGTCAGAAAACTATCTCACAAGATCTGGAGTTGGAATCACTTTTTCCAGGCATGTCTCCATGATCTGGAGTTGGAGAATGGTATTGCTGTTCTGAATAAAGGTTCTGCCATTGGTATTGGATTTGGAACTTTGGGATCGAAACTGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.09

Weight (kDa)

9.04

Isoelectric Point (pI)

16.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 79
AclWI GGATC 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 79
AjnI CCWGG 1 cut(s) 60
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 74
BglII AGATCT 1 cut(s) 36
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BpmI CTGGAG 2 cut(s) 61, 101
Bsc4I CCNNNNNNNGG 1 cut(s) 79
BseBI CCWGG 1 cut(s) 62
BseLI CCNNNNNNNGG 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 79
BsmAI GTCTC 1 cut(s) 74
Bsp143I GATC 3 cut(s) 36, 76, 149
BspPI GGATC 1 cut(s) 157
BssMI GATC 3 cut(s) 36, 76, 149
Bst2UI CCWGG 1 cut(s) 62
BstKTI GATC 3 cut(s) 39, 79, 152
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 3 cut(s) 36, 76, 149
BstNI CCWGG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 60
BstX2I RGATCY 1 cut(s) 36
BstYI RGATCY 1 cut(s) 36
CviAII CATG 2 cut(s) 66, 74
DpnI GATC 3 cut(s) 38, 78, 151
DpnII GATC 3 cut(s) 36, 76, 149
EcoRII CCWGG 1 cut(s) 60
FaeI CATG 2 cut(s) 69, 77
FaiI YATR 3 cut(s) 15, 67, 75
FatI CATG 2 cut(s) 65, 73
GsuI CTGGAG 2 cut(s) 61, 101
Hin1II CATG 2 cut(s) 69, 77
HinfI GANTC 1 cut(s) 49
Hpy188I TCNGA 2 cut(s) 20, 108
Hpy188III TCNNGA 2 cut(s) 40, 80
Hsp92II CATG 2 cut(s) 69, 77
Kzo9I GATC 3 cut(s) 36, 76, 149
LpnPI CCDG 4 cut(s) 25, 47, 65, 74
MalI GATC 3 cut(s) 38, 78, 151
MboI GATC 3 cut(s) 36, 76, 149
MflI RGATCY 1 cut(s) 36
MmeI TCCRAC 2 cut(s) 26, 66
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
NdeII GATC 3 cut(s) 36, 76, 149
NlaIII CATG 2 cut(s) 69, 77
NspI RCATGY 1 cut(s) 69
PfeI GAWTC 1 cut(s) 49
PflMI CCANNNNNTGG 1 cut(s) 79
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
PsuI RGATCY 1 cut(s) 36
Sau3AI GATC 3 cut(s) 36, 76, 149
ScrFI CCNGG 1 cut(s) 62
SetI ASST 1 cut(s) 118
SgeI CNNG 7 cut(s) 46, 52, 73, 74, 78, 86, 92
StyD4I CCNGG 1 cut(s) 60
TaqI TCGA 1 cut(s) 152
TfiI GAWTC 1 cut(s) 49
Van91I CCANNNNNTGG 1 cut(s) 79
XceI RCATGY 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.