RchiOBHm_Chr2g0097751

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
10305671 .. 10308365
2695 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47260

Sequence Viewer

Length: 204 bp
ATGCTGTGTTGTTCTGGGTTCATATCGAAAAGTCAAAACTATGAAGTGTTATTAGATCTAAAACTATCTCACAAGATCTGGAGTTGGAATCACTTTTTCCAGGCATGTCTCCATGATCTGGAGTTGGAGAATGGTATTGCTGTTCTGAATAAAGGTTCTGCCATTGGTATTGGATTTGGAACTTTGGGATCGAACCTGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.4

Weight (kDa)

6.23

Isoelectric Point (pI)

17.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 118
AclWI GGATC 1 cut(s) 196
AfiI CCNNNNNNNGG 1 cut(s) 118
AjnI CCWGG 1 cut(s) 99
Alw26I GTCTC 1 cut(s) 113
AlwI GGATC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 101
BcoDI GTCTC 1 cut(s) 113
BglII AGATCT 2 cut(s) 55, 75
Bme1390I CCNGG 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 101
BpmI CTGGAG 2 cut(s) 100, 140
Bsc4I CCNNNNNNNGG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 101
BseLI CCNNNNNNNGG 1 cut(s) 118
BslI CCNNNNNNNGG 1 cut(s) 118
BsmAI GTCTC 1 cut(s) 113
Bsp143I GATC 4 cut(s) 55, 75, 115, 188
BspPI GGATC 1 cut(s) 196
BssMI GATC 4 cut(s) 55, 75, 115, 188
Bst2UI CCWGG 1 cut(s) 101
BstKTI GATC 4 cut(s) 58, 78, 118, 191
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 4 cut(s) 55, 75, 115, 188
BstNI CCWGG 1 cut(s) 101
BstNSI RCATGY 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 99
BstX2I RGATCY 2 cut(s) 55, 75
BstYI RGATCY 2 cut(s) 55, 75
CviAII CATG 2 cut(s) 105, 113
DpnI GATC 4 cut(s) 57, 77, 117, 190
DpnII GATC 4 cut(s) 55, 75, 115, 188
EcoRII CCWGG 1 cut(s) 99
FaeI CATG 2 cut(s) 108, 116
FaiI YATR 4 cut(s) 23, 42, 106, 114
FatI CATG 2 cut(s) 104, 112
GsuI CTGGAG 2 cut(s) 100, 140
Hin1II CATG 2 cut(s) 108, 116
HinfI GANTC 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 2 cut(s) 79, 119
Hsp92II CATG 2 cut(s) 108, 116
Kzo9I GATC 4 cut(s) 55, 75, 115, 188
LpnPI CCDG 4 cut(s) 64, 86, 104, 113
MalI GATC 4 cut(s) 57, 77, 117, 190
MboI GATC 4 cut(s) 55, 75, 115, 188
MflI RGATCY 2 cut(s) 55, 75
MmeI TCCRAC 2 cut(s) 65, 105
MspR9I CCNGG 1 cut(s) 101
MvaI CCWGG 1 cut(s) 101
NdeII GATC 4 cut(s) 55, 75, 115, 188
NlaIII CATG 2 cut(s) 108, 116
NspI RCATGY 1 cut(s) 108
PfeI GAWTC 1 cut(s) 88
PflMI CCANNNNNTGG 1 cut(s) 118
Psp6I CCWGG 1 cut(s) 99
PspGI CCWGG 1 cut(s) 99
PsuI RGATCY 2 cut(s) 55, 75
Sau3AI GATC 4 cut(s) 55, 75, 115, 188
ScrFI CCNGG 1 cut(s) 101
SetI ASST 2 cut(s) 157, 198
SgeI CNNG 8 cut(s) 27, 85, 91, 112, 113, 117, 125, 131
StyD4I CCNGG 1 cut(s) 99
TaqI TCGA 2 cut(s) 26, 191
TfiI GAWTC 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 10, 57
Van91I CCANNNNNTGG 1 cut(s) 118
XceI RCATGY 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.