RchiOBHm_Chr6g0277391

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
39845152 .. 39852364
7213 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24884

Sequence Viewer

Length: 144 bp
ATGAGAGCTTTCCAACTATTGACAAAAGGACATGCAATTCTCAAAAAGAGGCTCAAGGCTTATTTTCAGAATAAGGACAAGTATGATGTTAGAGATTCGTATGAGAAGAAAGCTAAGGAGAGTTCAAAGTCGATCAGTAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.56

Weight (kDa)

10.06

Isoelectric Point (pI)

32.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 126
AluBI AGCT 2 cut(s) 8, 113
AluI AGCT 2 cut(s) 8, 113
BfaI CTAG 1 cut(s) 142
Bpu10I CCTNAGC 1 cut(s) 114
BpuEI CTTGAG 1 cut(s) 38
Bsp143I GATC 1 cut(s) 132
BssMI GATC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 114
BstKTI GATC 1 cut(s) 135
BstMBI GATC 1 cut(s) 132
BstNSI RCATGY 1 cut(s) 35
CviAII CATG 1 cut(s) 32
CviJI RGCY 4 cut(s) 8, 52, 59, 113
CviKI_1 RGCY 4 cut(s) 8, 52, 59, 113
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
FaeI CATG 1 cut(s) 35
FaiI YATR 3 cut(s) 33, 84, 102
FatI CATG 1 cut(s) 31
FspBI CTAG 1 cut(s) 142
FspEI CC 6 cut(s) 12, 26, 34, 41, 59, 101
Hin1II CATG 1 cut(s) 35
HinfI GANTC 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 69
HpyCH4V TGCA 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 1 cut(s) 35
Kzo9I GATC 1 cut(s) 132
MaeI CTAG 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 137
MalI GATC 1 cut(s) 134
MboI GATC 1 cut(s) 132
MboII GAAGA 1 cut(s) 118
MluCI AATT 1 cut(s) 36
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 1 cut(s) 42
NdeII GATC 1 cut(s) 132
NlaIII CATG 1 cut(s) 35
NspI RCATGY 1 cut(s) 35
PfeI GAWTC 1 cut(s) 95
Sau3AI GATC 1 cut(s) 132
SetI ASST 2 cut(s) 10, 115
SgeI CNNG 3 cut(s) 44, 67, 91
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 1 cut(s) 36
SspMI CTAG 1 cut(s) 142
TaqI TCGA 1 cut(s) 131
TasI AATT 1 cut(s) 36
TfiI GAWTC 1 cut(s) 95
XceI RCATGY 1 cut(s) 35
XspI CTAG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.