Rh7BG440800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
50852243 .. 50855173
2931 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG440800.1

Sequence Viewer

Length: 228 bp
ATGGATGCCATGCCACAACGTCGACTTTTTAACCGAAAACTATCTCACAAGATCTGGAGTTGGAATCAGTTTTTCCAGGCATATCTCCATGATCTGGAGTTGGAGAATGGTATTGGTGTTCTGAACAAAGGTCACACATTGCAGCTTCAAGCATTCTTCAAATCTTGCATACTCCATGGCTGGATGGACAAAATTTCCACTCTTACACTCTACAAAGCACGAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.92

Weight (kDa)

9.8

Isoelectric Point (pI)

44.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 94
AccI GTMKAC 1 cut(s) 22
AcsI RAATTY 1 cut(s) 192
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 2 cut(s) 149, 160
AjnI CCWGG 1 cut(s) 75
AluBI AGCT 2 cut(s) 145, 225
AluI AGCT 2 cut(s) 145, 225
ApeKI GCWGC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 192
BbvI GCAGC 1 cut(s) 154
BccI CCATC 1 cut(s) 178
BciT130I CCWGG 1 cut(s) 77
BglII AGATCT 1 cut(s) 51
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 77
BmrFI CCNGG 1 cut(s) 77
BpmI CTGGAG 2 cut(s) 76, 116
BsaJI CCNNGG 1 cut(s) 175
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse3DI GCAATG 1 cut(s) 137
BseBI CCWGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 175
BseGI GGATG 2 cut(s) 10, 189
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMI GCAATG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 154
BslI CCNNNNNNNGG 1 cut(s) 94
BsmI GAATGC 1 cut(s) 152
Bsp143I GATC 2 cut(s) 51, 91
Bsp19I CCATGG 1 cut(s) 175
BsrDI GCAATG 1 cut(s) 137
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 2 cut(s) 51, 91
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 77
BstDSI CCRYGG 1 cut(s) 175
BstF5I GGATG 2 cut(s) 10, 189
BstKTI GATC 2 cut(s) 54, 94
BstMBI GATC 2 cut(s) 51, 91
BstNI CCWGG 1 cut(s) 77
BstSCI CCNGG 1 cut(s) 75
BstV1I GCAGC 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 51
BstYI RGATCY 1 cut(s) 51
BtgI CCRYGG 1 cut(s) 175
BtsCI GGATG 2 cut(s) 10, 189
CviAII CATG 3 cut(s) 10, 89, 176
CviJI RGCY 3 cut(s) 145, 180, 225
CviKI_1 RGCY 3 cut(s) 145, 180, 225
DpnI GATC 2 cut(s) 53, 93
DpnII GATC 2 cut(s) 51, 91
Eco130I CCWWGG 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 75
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 3 cut(s) 13, 92, 179
FaiI YATR 5 cut(s) 11, 82, 90, 170, 177
FatI CATG 3 cut(s) 9, 88, 175
FblI GTMKAC 1 cut(s) 22
Fnu4HI GCNGC 1 cut(s) 143
FokI GGATG 2 cut(s) 17, 196
Fsp4HI GCNGC 1 cut(s) 143
GluI GCNGC 1 cut(s) 143
GsuI CTGGAG 2 cut(s) 76, 116
Hin1II CATG 3 cut(s) 13, 92, 179
HincII GTYRAC 1 cut(s) 23
HindII GTYRAC 1 cut(s) 23
HinfI GANTC 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 123
Hpy188III TCNNGA 2 cut(s) 55, 95
Hpy8I GTNNAC 1 cut(s) 23
Hpy99I CGWCG 1 cut(s) 24
HpyCH4IV ACGT 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 142, 168
HpySE526I ACGT 1 cut(s) 19
Hsp92II CATG 3 cut(s) 13, 92, 179
Kzo9I GATC 2 cut(s) 51, 91
LpnPI CCDG 5 cut(s) 40, 62, 80, 89, 166
Lsp1109I GCAGC 1 cut(s) 154
MaeII ACGT 1 cut(s) 19
MaeIII GTNAC 1 cut(s) 131
MalI GATC 2 cut(s) 53, 93
MboI GATC 2 cut(s) 51, 91
MboII GAAGA 1 cut(s) 148
MflI RGATCY 1 cut(s) 51
MluCI AATT 1 cut(s) 192
MmeI TCCRAC 2 cut(s) 41, 81
MseI TTAA 1 cut(s) 30
MspR9I CCNGG 1 cut(s) 77
Mva1269I GAATGC 1 cut(s) 152
MvaI CCWGG 1 cut(s) 77
NcoI CCATGG 1 cut(s) 175
NdeII GATC 2 cut(s) 51, 91
NlaIII CATG 3 cut(s) 13, 92, 179
NmuCI GTSAC 1 cut(s) 131
PctI GAATGC 1 cut(s) 152
PfeI GAWTC 1 cut(s) 64
PflMI CCANNNNNTGG 1 cut(s) 94
PkrI GCNGC 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 75
PspGI CCWGG 1 cut(s) 75
PsuI RGATCY 1 cut(s) 51
SalI GTCGAC 1 cut(s) 21
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 1 cut(s) 143
Sau3AI GATC 2 cut(s) 51, 91
ScrFI CCNGG 1 cut(s) 77
SetI ASST 4 cut(s) 22, 133, 147, 227
Sse9I AATT 1 cut(s) 192
StyD4I CCNGG 1 cut(s) 75
StyI CCWWGG 1 cut(s) 175
TaiI ACGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 22
TasI AATT 1 cut(s) 192
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TseFI GTSAC 1 cut(s) 131
TseI GCWGC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 131
Van91I CCANNNNNTGG 1 cut(s) 94
XapI RAATTY 1 cut(s) 192
XmiI GTMKAC 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.