Rh3AG337900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
49385263 .. 49390028
4766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG337900.1

Sequence Viewer

Length: 228 bp
ATGAGGTATCCATTGCTACTGCTGGAGCTGTGGACAGTCATTTTATGGGGGAAGACCTCCAATCCCTTAAGTATGAAAGAGCTTCAGATTTGGAGCAGCAACTTTACTCTGAAGCACATAAGATCTAGAAAGGGGACTAGAATAATGGGATTGGATTATAAGACTGCTGCACATCTTGAGAATCATTTGACCAATTTGGATGAAAAGAAGTTTGGTATCAACCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.81

Weight (kDa)

9.9

Isoelectric Point (pI)

24.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 159
AcuI CTGAAG 2 cut(s) 68, 131
AflII CTTAAG 1 cut(s) 67
AjuI GAANNNNNNNTTGG 2 cut(s) 195, 227
AluBI AGCT 2 cut(s) 28, 82
AluI AGCT 2 cut(s) 28, 82
ApeKI GCWGC 2 cut(s) 96, 167
BbsI GAAGAC 1 cut(s) 59
BbvI GCAGC 2 cut(s) 108, 154
BciVI GTATCC 1 cut(s) 18
BfaI CTAG 2 cut(s) 126, 138
BfrI CTTAAG 1 cut(s) 67
BfuI GTATCC 1 cut(s) 18
BglII AGATCT 1 cut(s) 122
BisI GCNGC 2 cut(s) 97, 168
BlsI GCNGC 2 cut(s) 98, 169
BpiI GAAGAC 1 cut(s) 59
BpmI CTGGAG 1 cut(s) 44
BpuEI CTTGAG 1 cut(s) 197
Bse3DI GCAATG 1 cut(s) 11
BseGI GGATG 1 cut(s) 205
BseMI GCAATG 1 cut(s) 11
BseXI GCAGC 2 cut(s) 108, 154
BsgI GTGCAG 1 cut(s) 153
BslFI GGGAC 1 cut(s) 148
BsmFI GGGAC 1 cut(s) 148
Bsp143I GATC 1 cut(s) 122
BspTI CTTAAG 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 11
BssMI GATC 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 37
BstAFI CTTAAG 1 cut(s) 67
BstF5I GGATG 1 cut(s) 205
BstKTI GATC 1 cut(s) 125
BstMBI GATC 1 cut(s) 122
BstV1I GCAGC 2 cut(s) 108, 154
BstV2I GAAGAC 1 cut(s) 59
BstX2I RGATCY 1 cut(s) 122
BstYI RGATCY 1 cut(s) 122
BsuI GTATCC 1 cut(s) 18
BtsCI GGATG 1 cut(s) 205
CviJI RGCY 2 cut(s) 28, 82
CviKI_1 RGCY 2 cut(s) 28, 82
DpnI GATC 1 cut(s) 124
DpnII GATC 1 cut(s) 122
Eco57I CTGAAG 2 cut(s) 68, 131
FaiI YATR 4 cut(s) 46, 74, 119, 159
FaqI GGGAC 1 cut(s) 148
Fnu4HI GCNGC 2 cut(s) 97, 168
FokI GGATG 1 cut(s) 212
Fsp4HI GCNGC 2 cut(s) 97, 168
FspBI CTAG 2 cut(s) 126, 138
GluI GCNGC 2 cut(s) 97, 168
GsuI CTGGAG 1 cut(s) 44
HinfI GANTC 1 cut(s) 181
Hpy166II GTNNAC 1 cut(s) 33
Hpy188I TCNGA 2 cut(s) 87, 111
Hpy188III TCNNGA 2 cut(s) 126, 176
Hpy8I GTNNAC 1 cut(s) 33
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 170
Kzo9I GATC 1 cut(s) 122
LmnI GCTCC 2 cut(s) 25, 93
LpnPI CCDG 1 cut(s) 8
Lsp1109I GCAGC 2 cut(s) 108, 154
MaeI CTAG 2 cut(s) 126, 138
MalI GATC 1 cut(s) 124
MboI GATC 1 cut(s) 122
MboII GAAGA 1 cut(s) 64
MflI RGATCY 1 cut(s) 122
MluCI AATT 1 cut(s) 193
MnlI CCTC 1 cut(s) 67
MseI TTAA 1 cut(s) 68
MspCI CTTAAG 1 cut(s) 67
NdeII GATC 1 cut(s) 122
PfeI GAWTC 1 cut(s) 181
PkrI GCNGC 2 cut(s) 98, 169
PsiI TTATAA 1 cut(s) 159
PsuI RGATCY 1 cut(s) 122
SaqAI TTAA 1 cut(s) 68
SatI GCNGC 2 cut(s) 97, 168
Sau3AI GATC 1 cut(s) 122
SetI ASST 4 cut(s) 8, 30, 59, 84
SgeI CNNG 4 cut(s) 35, 138, 150, 188
SmlI CTYRAG 2 cut(s) 67, 176
SmoI CTYRAG 2 cut(s) 67, 176
Sse9I AATT 1 cut(s) 193
SspMI CTAG 2 cut(s) 126, 138
TaaI ACNGT 1 cut(s) 37
TasI AATT 1 cut(s) 193
TfiI GAWTC 1 cut(s) 181
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TseI GCWGC 2 cut(s) 96, 167
TspDTI ATGAA 2 cut(s) 89, 216
Vha464I CTTAAG 1 cut(s) 67
XbaI TCTAGA 1 cut(s) 125
XspI CTAG 2 cut(s) 126, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.