Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0003585

Physical Location & Seq

Genomic Coordinates Reverse (-)

53785193 .. 53788989

Gene Structure 3797 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ58693

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

ATGACTCGGGAAATTTTTGTTATGAGGCTATGGAAGGGAAAGCTTGTTAAGCATATAGGACTGGAAAGTAAAAACAATCCTAATTTAGGATTGGAACCTGATGACACTCCTCATCAAGATCTCAAGACTACAGGATTGAAGTTTGGTAACAATCCTGATACGGGATTGAGAGGCAATAGTGGTCCAAGACTAGACAATATGCAGGTCTCTGCTCACATCAGTGCCAAAGCACAACCTTATGCTCCAAGACATAGAACAGATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

87

Amino Acids

9.73

Weight (kDa)

9.77

Isoelectric Point (pI)

21.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003585)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G21865
fragaria_vesca	FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630
malus_domestica	MD16G1226400.v1.1
prunus_persica	Prupe.1G048400_v2.0.a1 Prupe.1G048400_v2.0.a1 Prupe.1G048400_v2.0.a1
pyrus_communis	pycom16g18960
rosa_chinensis	RchiOBHm_Chr1g0362101 RchiOBHm_Chr4g0395401
rosa_laevigata	RLG00000009625
rosa_multiflora	Rmu_sc0004598.1_g000001 Rmu_sc0010817.1_g000013
rosa_roxburghii	Rroxscaffold_5G00340360
rosa_rugosa	Rorug01G0293700 Rorug03G0357600
rosa_samantha	Rh1AG304400 Rh2BG188400 Rh4AG059600 Rh4BG058100 Rh4CG063600 Rh4DG054700 Rh6AG105300 Rh7AG389000 Rh7CG408200 Rh7DG387000
rosa_wichuraiana	Rw0G003300 Rw0G007660 Rw4G004760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	193
AcsI	RAATTY	1 cut(s)	12
AfiI	CCNNNNNNNGG	2 cut(s)	86, 161
AgsI	TTSAA	1 cut(s)	139
AleI	CACNNNNGTG	1 cut(s)	219
AluBI	AGCT	1 cut(s)	43
AluI	AGCT	1 cut(s)	43
Alw26I	GTCTC	1 cut(s)	211
Ama87I	CYCGRG	1 cut(s)	6
ApoI	RAATTY	1 cut(s)	12
AspS9I	GGNCC	1 cut(s)	182
AvaI	CYCGRG	1 cut(s)	6
AvaII	GGWCC	1 cut(s)	182
BcoDI	GTCTC	1 cut(s)	211
BfaI	CTAG	1 cut(s)	191
BfmI	CTRYAG	1 cut(s)	129
BfuAI	ACCTGC	1 cut(s)	193
BglII	AGATCT	1 cut(s)	118
Bme18I	GGWCC	1 cut(s)	182
BmeT110I	CYCGRG	1 cut(s)	6
BmgT120I	GGNCC	1 cut(s)	182
BmiI	GGNNCC	1 cut(s)	96
BpuEI	CTTGAG	1 cut(s)	107
BsaI	GGTCTC	1 cut(s)	211
Bsc4I	CCNNNNNNNGG	2 cut(s)	86, 161
Bse1I	ACTGG	1 cut(s)	66
BseLI	CCNNNNNNNGG	2 cut(s)	86, 161
BseNI	ACTGG	1 cut(s)	66
BseRI	GAGGAG	1 cut(s)	99
BsiHKCI	CYCGRG	1 cut(s)	6
BslI	CCNNNNNNNGG	2 cut(s)	86, 161
BsmAI	GTCTC	1 cut(s)	211
Bso31I	GGTCTC	1 cut(s)	211
BsoBI	CYCGRG	1 cut(s)	6
Bsp143I	GATC	1 cut(s)	118
BspLI	GGNNCC	1 cut(s)	96
BspMI	ACCTGC	1 cut(s)	193
BspTNI	GGTCTC	1 cut(s)	211
BsrI	ACTGG	1 cut(s)	66
BssMI	GATC	1 cut(s)	118
BstENI	CCTNNNNNAGG	1 cut(s)	84
BstKTI	GATC	1 cut(s)	121
BstMAI	GTCTC	1 cut(s)	211
BstMBI	GATC	1 cut(s)	118
BstMWI	GCNNNNNNNGC	1 cut(s)	49
BstSFI	CTRYAG	1 cut(s)	129
BstX2I	RGATCY	1 cut(s)	118
BstYI	RGATCY	1 cut(s)	118
BtsIMutI	CAGTG	1 cut(s)	226
BveI	ACCTGC	1 cut(s)	193
Cfr13I	GGNCC	1 cut(s)	182
CviJI	RGCY	2 cut(s)	28, 43
CviKI_1	RGCY	2 cut(s)	28, 43
DpnI	GATC	1 cut(s)	120
DpnII	GATC	1 cut(s)	118
Eco31I	GGTCTC	1 cut(s)	211
Eco47I	GGWCC	1 cut(s)	182
Eco88I	CYCGRG	1 cut(s)	6
EcoNI	CCTNNNNNAGG	1 cut(s)	84
FaiI	YATR	7 cut(s)	23, 31, 54, 56, 200, 240, 252
FspBI	CTAG	1 cut(s)	191
HindIII	AAGCTT	1 cut(s)	41
HinfI	GANTC	1 cut(s)	4
Hpy188III	TCNNGA	4 cut(s)	8, 116, 124, 155
HpyAV	CCTTC	1 cut(s)	28
HpyCH4V	TGCA	1 cut(s)	202
HpyF10VI	GCNNNNNNNGC	1 cut(s)	49
Kzo9I	GATC	1 cut(s)	118
LmnI	GCTCC	1 cut(s)	247
LpnPI	CCDG	5 cut(s)	47, 111, 117, 168, 188
MaeI	CTAG	1 cut(s)	191
MaeIII	GTNAC	1 cut(s)	146
MalI	GATC	1 cut(s)	120
MboI	GATC	1 cut(s)	118
MflI	RGATCY	1 cut(s)	118
MluCI	AATT	2 cut(s)	12, 82
MnlI	CCTC	3 cut(s)	18, 120, 164
MseI	TTAA	1 cut(s)	48
MslI	CAYNNNNRTG	1 cut(s)	219
MwoI	GCNNNNNNNGC	1 cut(s)	49
NdeII	GATC	1 cut(s)	118
NlaIV	GGNNCC	1 cut(s)	96
OliI	CACNNNNGTG	1 cut(s)	219
PspN4I	GGNNCC	1 cut(s)	96
PspPI	GGNCC	1 cut(s)	182
PsuI	RGATCY	1 cut(s)	118
RseI	CAYNNNNRTG	1 cut(s)	219
SaqAI	TTAA	1 cut(s)	48
Sau3AI	GATC	1 cut(s)	118
Sau96I	GGNCC	1 cut(s)	182
SetI	ASST	4 cut(s)	45, 100, 207, 238
SfcI	CTRYAG	1 cut(s)	129
SinI	GGWCC	1 cut(s)	182
SmiMI	CAYNNNNRTG	1 cut(s)	219
SmlI	CTYRAG	1 cut(s)	122
SmoI	CTYRAG	1 cut(s)	122
Sse9I	AATT	2 cut(s)	12, 82
SspMI	CTAG	1 cut(s)	191
TasI	AATT	2 cut(s)	12, 82
Tru1I	TTAA	1 cut(s)	48
Tru9I	TTAA	1 cut(s)	48
TscAI	CASTG	1 cut(s)	226
TspRI	CASTG	1 cut(s)	226
VpaK11BI	GGWCC	1 cut(s)	182
XagI	CCTNNNNNAGG	1 cut(s)	84
XapI	RAATTY	1 cut(s)	12
XspI	CTAG	1 cut(s)	191

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.