Rh6AG105300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
15523271 .. 15523926
656 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG105300.1

Sequence Viewer

Length: 360 bp
ATGGTGTTAATTGTTAAGGATATAGGACTGGAAAGTAAAAACAATCCTAATTTAGGATTGGAACCCGATGACACTCCTTATCAAGATCTCAAGACTATGGGATTGAAGTTTGGTAACAATCCTGATACCGGATTGAGAGGCAATAGTGGTCCAAGACTAGACGATATGCAGGCCTCTGCTCACATCAGTGCCAAAGCACAACCTTATGCTCCAAGACATAAGATTCCATCTGCTGGAGCAGTGGAGCAGACCAGCACAAAGCAAGACAAGGAGGAGCCTTTGAATTGTACTAAGCTCACAATCACCATACACATATTTACCTTGAATTGTATAGGCCAAATGCCAAAAGGGTCAACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

12.89

Weight (kDa)

6.82

Isoelectric Point (pI)

34.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 233
AfaI GTAC 1 cut(s) 289
AfiI CCNNNNNNNGG 3 cut(s) 53, 128, 233
AgsI TTSAA 3 cut(s) 106, 283, 325
AleI CACNNNNGTG 1 cut(s) 186
AluBI AGCT 1 cut(s) 295
AluI AGCT 1 cut(s) 295
AoxI GGCC 2 cut(s) 171, 334
AspS9I GGNCC 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 295
AvaII GGWCC 1 cut(s) 149
BccI CCATC 1 cut(s) 235
BfaI CTAG 1 cut(s) 158
BglII AGATCT 1 cut(s) 85
Bme18I GGWCC 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 149
BmiI GGNNCC 2 cut(s) 63, 276
BpmI CTGGAG 1 cut(s) 255
BpuEI CTTGAG 1 cut(s) 74
BsaWI WCCGGW 1 cut(s) 128
Bsc4I CCNNNNNNNGG 3 cut(s) 53, 128, 233
Bse1I ACTGG 1 cut(s) 33
BseLI CCNNNNNNNGG 3 cut(s) 53, 128, 233
BseNI ACTGG 1 cut(s) 33
BseRI GAGGAG 1 cut(s) 287
BshFI GGCC 2 cut(s) 173, 336
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 3 cut(s) 53, 128, 233
BsnI GGCC 2 cut(s) 173, 336
Bsp143I GATC 1 cut(s) 85
BspANI GGCC 2 cut(s) 173, 336
BspLI GGNNCC 2 cut(s) 63, 276
BsrI ACTGG 1 cut(s) 33
BssMI GATC 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 291
BstENI CCTNNNNNAGG 1 cut(s) 51
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
BsuRI GGCC 2 cut(s) 173, 336
BtsI GCAGTG 1 cut(s) 246
BtsIMutI CAGTG 2 cut(s) 193, 246
Cac8I GCNNGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 288
CviJI RGCY 4 cut(s) 173, 277, 295, 336
CviKI_1 RGCY 4 cut(s) 173, 277, 295, 336
CviQI GTAC 1 cut(s) 288
DdeI CTNAG 1 cut(s) 291
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eco147I AGGCCT 1 cut(s) 173
Eco47I GGWCC 1 cut(s) 149
EcoNI CCTNNNNNAGG 1 cut(s) 51
FaiI YATR 9 cut(s) 23, 98, 167, 207, 219, 308, 314, 332, 358
FspBI CTAG 1 cut(s) 158
GsuI CTGGAG 1 cut(s) 255
HaeIII GGCC 2 cut(s) 173, 336
HapII CCGG 1 cut(s) 129
HincII GTYRAC 1 cut(s) 354
HindII GTYRAC 1 cut(s) 354
HinfI GANTC 1 cut(s) 223
HpaII CCGG 1 cut(s) 129
HphI GGTGA 1 cut(s) 295
Hpy166II GTNNAC 1 cut(s) 354
Hpy188III TCNNGA 3 cut(s) 83, 91, 122
Hpy8I GTNNAC 1 cut(s) 354
HpyCH4V TGCA 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 291
Kzo9I GATC 1 cut(s) 85
LmnI GCTCC 4 cut(s) 214, 236, 244, 274
LpnPI CCDG 6 cut(s) 14, 135, 142, 155, 219, 265
MaeI CTAG 1 cut(s) 158
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MflI RGATCY 1 cut(s) 85
MluCI AATT 4 cut(s) 9, 49, 283, 325
MnlI CCTC 3 cut(s) 131, 184, 265
MseI TTAA 2 cut(s) 8, 15
MslI CAYNNNNRTG 1 cut(s) 186
MspI CCGG 1 cut(s) 129
NdeII GATC 1 cut(s) 85
NlaIV GGNNCC 2 cut(s) 63, 276
OliI CACNNNNGTG 1 cut(s) 186
PceI AGGCCT 1 cut(s) 173
PfeI GAWTC 1 cut(s) 223
PflMI CCANNNNNTGG 1 cut(s) 233
PspN4I GGNNCC 2 cut(s) 63, 276
PspPI GGNCC 1 cut(s) 149
PsuI RGATCY 1 cut(s) 85
RsaI GTAC 1 cut(s) 289
RsaNI GTAC 1 cut(s) 288
RseI CAYNNNNRTG 1 cut(s) 186
SaqAI TTAA 2 cut(s) 8, 15
Sau3AI GATC 1 cut(s) 85
Sau96I GGNCC 1 cut(s) 149
SetI ASST 3 cut(s) 205, 297, 323
SinI GGWCC 1 cut(s) 149
SmiMI CAYNNNNRTG 1 cut(s) 186
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 4 cut(s) 9, 49, 283, 325
SseBI AGGCCT 1 cut(s) 173
SspMI CTAG 1 cut(s) 158
StuI AGGCCT 1 cut(s) 173
TasI AATT 4 cut(s) 9, 49, 283, 325
TatI WGTACW 1 cut(s) 287
TfiI GAWTC 1 cut(s) 223
Tru1I TTAA 2 cut(s) 8, 15
Tru9I TTAA 2 cut(s) 8, 15
TscAI CASTG 2 cut(s) 193, 246
TspRI CASTG 2 cut(s) 193, 246
Van91I CCANNNNNTGG 1 cut(s) 233
VpaK11BI GGWCC 1 cut(s) 149
XagI CCTNNNNNAGG 1 cut(s) 51
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.