Rmu_sc0010817.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010817.1
Physical Location & Seq
Reverse (-)
33954 .. 37155
3202 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010817.1_g000013.1.cds

Sequence Viewer

Length: 633 bp
atgagtctaaagtctctaccttcaggggcttttgacctctcccttcaacaactactgaagaacctctcaaacacaatgtacgtgtatcccaaggtgaaggtcaggcaacaagaagagaaagatgatcaatatgcccttcttgatttttctactccagtgaaggacaaagatgtttctccagctactgttgcaaaagctccaaaatcttatgttccaagagtagttatgccatcgatctctgttgctgaaggagcaaagaaggccaataagattgaagagatgaataaacaaaatattagagccagctcaatccctccacctcgtgctgtcttatccagtcctgacaatgatacggtgattggaaacaaaaataggatcaaagcacaacgaccatctgctctgaagaatcatagcttggttcagaatagaagattgaagtttggtgacaatcctgatacgggattgagaggcaatagtggtccaaaactagacaatatgcaggtctctgctcacatcagtgccaaagcacaaccttatgctccaagacatagaacagataagattccatctgactggagcagtggagcagacaagcacaaagcaagacaaggaggagcctttgaattgtactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

210

Amino Acids

23.15

Weight (kDa)

9.93

Isoelectric Point (pI)

49.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 490
AclWI GGATC 1 cut(s) 383
AcuI CTGAAG 4 cut(s) 6, 77, 267, 422
AdeI CACNNNGTG 1 cut(s) 323
AfaI GTAC 2 cut(s) 80, 629
AfiI CCNNNNNNNGG 1 cut(s) 458
AflIII ACRYGT 1 cut(s) 81
AgsI TTSAA 4 cut(s) 47, 275, 436, 623
AjuI GAANNNNNNNTTGG 2 cut(s) 398, 430
AleI CACNNNNGTG 1 cut(s) 516
AluBI AGCT 4 cut(s) 182, 197, 306, 414
AluI AGCT 4 cut(s) 182, 197, 306, 414
Alw26I GTCTC 2 cut(s) 18, 508
AlwI GGATC 1 cut(s) 383
AlwNI CAGNNNCTG 1 cut(s) 185
AoxI GGCC 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 479
AsuHPI GGTGA 3 cut(s) 106, 367, 455
AvaII GGWCC 1 cut(s) 479
BauI CACGAG 1 cut(s) 321
BccI CCATC 3 cut(s) 238, 400, 574
BciVI GTATCC 1 cut(s) 96
BclI TGATCA 1 cut(s) 124
BcoDI GTCTC 2 cut(s) 18, 508
BfaI CTAG 1 cut(s) 488
BfuAI ACCTGC 1 cut(s) 490
BfuI GTATCC 1 cut(s) 96
Bme18I GGWCC 1 cut(s) 479
BmgT120I GGNCC 1 cut(s) 479
BmiI GGNNCC 1 cut(s) 616
BpmI CTGGAG 3 cut(s) 138, 162, 595
Bsa29I ATCGAT 1 cut(s) 233
BsaAI YACGTR 1 cut(s) 82
BsaI GGTCTC 1 cut(s) 508
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 458
Bse1I ACTGG 3 cut(s) 155, 336, 578
BseCI ATCGAT 1 cut(s) 233
BseDI CCNNGG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 458
BseNI ACTGG 3 cut(s) 155, 336, 578
BseRI GAGGAG 1 cut(s) 627
BshFI GGCC 1 cut(s) 263
BshVI ATCGAT 1 cut(s) 233
BslI CCNNNNNNNGG 1 cut(s) 458
BsmAI GTCTC 2 cut(s) 18, 508
BsnI GGCC 1 cut(s) 263
Bso31I GGTCTC 1 cut(s) 508
Bsp143I GATC 3 cut(s) 124, 234, 375
BspANI GGCC 1 cut(s) 263
BspDI ATCGAT 1 cut(s) 233
BspLI GGNNCC 1 cut(s) 616
BspMI ACCTGC 1 cut(s) 490
BspPI GGATC 1 cut(s) 383
BspTNI GGTCTC 1 cut(s) 508
BsrI ACTGG 3 cut(s) 155, 336, 578
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 3 cut(s) 124, 234, 375
BssSI CACGAG 1 cut(s) 321
BssT1I CCWWGG 1 cut(s) 90
Bst2BI CACGAG 1 cut(s) 321
Bst4CI ACNGT 2 cut(s) 187, 355
Bst6I CTCTTC 2 cut(s) 108, 270
BstBAI YACGTR 1 cut(s) 82
BstC8I GCNNGC 1 cut(s) 304
BstKTI GATC 3 cut(s) 127, 237, 378
BstMAI GTCTC 2 cut(s) 18, 508
BstMBI GATC 3 cut(s) 124, 234, 375
BstMWI GCNNNNNNNGC 3 cut(s) 188, 251, 260
BstXI CCANNNNNNTGG 1 cut(s) 573
Bsu15I ATCGAT 1 cut(s) 233
BsuI GTATCC 1 cut(s) 96
BsuRI GGCC 1 cut(s) 263
BsuTUI ATCGAT 1 cut(s) 233
BtsI GCAGTG 1 cut(s) 586
BtsIMutI CAGTG 3 cut(s) 162, 523, 586
BveI ACCTGC 1 cut(s) 490
Cac8I GCNNGC 1 cut(s) 304
CaiI CAGNNNCTG 1 cut(s) 185
Cfr13I GGNCC 1 cut(s) 479
ClaI ATCGAT 1 cut(s) 233
Csp6I GTAC 2 cut(s) 79, 628
CviJI RGCY 8 cut(s) 29, 182, 197, 263, 302, 306, 414, 617
CviKI_1 RGCY 8 cut(s) 29, 182, 197, 263, 302, 306, 414, 617
CviQI GTAC 2 cut(s) 79, 628
DpnI GATC 3 cut(s) 126, 236, 377
DpnII GATC 3 cut(s) 124, 234, 375
DraIII CACNNNGTG 1 cut(s) 323
Eam1104I CTCTTC 2 cut(s) 108, 270
EarI CTCTTC 2 cut(s) 108, 270
Eco130I CCWWGG 1 cut(s) 90
Eco31I GGTCTC 1 cut(s) 508
Eco47I GGWCC 1 cut(s) 479
Eco57I CTGAAG 4 cut(s) 6, 77, 267, 422
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaiI YATR 7 cut(s) 132, 210, 227, 411, 497, 537, 549
FbaI TGATCA 1 cut(s) 124
FspBI CTAG 1 cut(s) 488
GsuI CTGGAG 3 cut(s) 138, 162, 595
HaeIII GGCC 1 cut(s) 263
HinfI GANTC 3 cut(s) 4, 406, 562
HphI GGTGA 3 cut(s) 106, 367, 455
Hpy188I TCNGA 3 cut(s) 402, 423, 571
Hpy188III TCNNGA 3 cut(s) 140, 341, 452
HpyAV CCTTC 7 cut(s) 30, 53, 91, 146, 154, 242, 253
HpyCH4III ACNGT 2 cut(s) 187, 355
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 191, 499
HpyF10VI GCNNNNNNNGC 3 cut(s) 188, 251, 260
HpySE526I ACGT 1 cut(s) 81
Ksp22I TGATCA 1 cut(s) 124
Kzo9I GATC 3 cut(s) 124, 234, 375
LmnI GCTCC 6 cut(s) 202, 251, 544, 576, 584, 614
MaeI CTAG 1 cut(s) 488
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 443
MalI GATC 3 cut(s) 126, 236, 377
MboI GATC 3 cut(s) 124, 234, 375
MboII GAAGA 5 cut(s) 70, 125, 287, 415, 441
MluCI AATT 1 cut(s) 623
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 6 cut(s) 47, 74, 324, 330, 461, 605
MslI CAYNNNNRTG 1 cut(s) 516
MwoI GCNNNNNNNGC 3 cut(s) 188, 251, 260
NdeII GATC 3 cut(s) 124, 234, 375
NlaIV GGNNCC 1 cut(s) 616
NmuCI GTSAC 1 cut(s) 443
OliI CACNNNNGTG 1 cut(s) 516
PfeI GAWTC 2 cut(s) 406, 562
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
Ppu21I YACGTR 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 616
PspPI GGNCC 1 cut(s) 479
PstNI CAGNNNCTG 1 cut(s) 185
RsaI GTAC 2 cut(s) 80, 629
RsaNI GTAC 2 cut(s) 79, 628
RseI CAYNNNNRTG 1 cut(s) 516
Sau3AI GATC 3 cut(s) 124, 234, 375
Sau96I GGNCC 1 cut(s) 479
SchI GAGTC 1 cut(s) 13
SinI GGWCC 1 cut(s) 479
SmiMI CAYNNNNRTG 1 cut(s) 516
Sse9I AATT 1 cut(s) 623
SspI AATATT 1 cut(s) 295
SspMI CTAG 1 cut(s) 488
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 2 cut(s) 187, 355
TaiI ACGT 1 cut(s) 84
TaqI TCGA 1 cut(s) 233
TasI AATT 1 cut(s) 623
TatI WGTACW 1 cut(s) 627
TfiI GAWTC 2 cut(s) 406, 562
TscAI CASTG 3 cut(s) 162, 523, 586
TseFI GTSAC 1 cut(s) 443
Tsp45I GTSAC 1 cut(s) 443
TspDTI ATGAA 1 cut(s) 296
TspRI CASTG 3 cut(s) 162, 523, 586
VpaK11BI GGWCC 1 cut(s) 479
XspI CTAG 1 cut(s) 488
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.