Rh7AG389000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
50981002 .. 50981187
186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG389000.1

Sequence Viewer

Length: 186 bp
ATGGGATTGAAGTTTGGTAACAATCCTGATACCGGATTGAGAGGCAATAGTGGTCCAAGACTAGACGATATGCAGGCCTCTGCTCACATCAGTGCCAAAGCACAACCTTATGCTCCAAGACATAAGATTCCATCTGACTGGAGCAGTGGAGCAGACGCTCAAAGCAAGACAAGGAGGAGCCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.55

Weight (kDa)

10.15

Isoelectric Point (pI)

46.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 1 cut(s) 10
AleI CACNNNNGTG 1 cut(s) 90
AoxI GGCC 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 53
AvaII GGWCC 1 cut(s) 53
BccI CCATC 1 cut(s) 139
BfaI CTAG 1 cut(s) 62
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BmiI GGNNCC 1 cut(s) 179
BpmI CTGGAG 1 cut(s) 160
BsaWI WCCGGW 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 143
BseLI CCNNNNNNNGG 1 cut(s) 32
BseNI ACTGG 1 cut(s) 143
BshFI GGCC 1 cut(s) 77
BsiSI CCGG 1 cut(s) 33
BslI CCNNNNNNNGG 1 cut(s) 32
BsnI GGCC 1 cut(s) 77
BspANI GGCC 1 cut(s) 77
BspLI GGNNCC 1 cut(s) 179
BsrI ACTGG 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 75
BstXI CCANNNNNNTGG 1 cut(s) 138
BsuRI GGCC 1 cut(s) 77
BtsI GCAGTG 1 cut(s) 151
BtsIMutI CAGTG 2 cut(s) 97, 151
Cac8I GCNNGC 1 cut(s) 75
Cfr13I GGNCC 1 cut(s) 53
CseI GACGC 1 cut(s) 164
CviJI RGCY 2 cut(s) 77, 180
CviKI_1 RGCY 2 cut(s) 77, 180
Eco147I AGGCCT 1 cut(s) 77
Eco47I GGWCC 1 cut(s) 53
FaiI YATR 3 cut(s) 71, 111, 123
FspBI CTAG 1 cut(s) 62
GsuI CTGGAG 1 cut(s) 160
HaeIII GGCC 1 cut(s) 77
HapII CCGG 1 cut(s) 33
HgaI GACGC 1 cut(s) 164
HinfI GANTC 1 cut(s) 127
HpaII CCGG 1 cut(s) 33
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 73
LmnI GCTCC 4 cut(s) 118, 141, 149, 177
LpnPI CCDG 4 cut(s) 39, 46, 59, 124
MaeI CTAG 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 17
MnlI CCTC 3 cut(s) 35, 88, 168
MslI CAYNNNNRTG 1 cut(s) 90
MspI CCGG 1 cut(s) 33
NlaIV GGNNCC 1 cut(s) 179
OliI CACNNNNGTG 1 cut(s) 90
PceI AGGCCT 1 cut(s) 77
PfeI GAWTC 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 179
PspPI GGNCC 1 cut(s) 53
RseI CAYNNNNRTG 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 53
SetI ASST 1 cut(s) 109
SgeI CNNG 8 cut(s) 38, 45, 69, 74, 86, 129, 151, 178
SinI GGWCC 1 cut(s) 53
SmiMI CAYNNNNRTG 1 cut(s) 90
SseBI AGGCCT 1 cut(s) 77
SspMI CTAG 1 cut(s) 62
StuI AGGCCT 1 cut(s) 77
TfiI GAWTC 1 cut(s) 127
TscAI CASTG 2 cut(s) 97, 151
TspRI CASTG 2 cut(s) 97, 151
VpaK11BI GGWCC 1 cut(s) 53
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.