Rh1AG304400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
53670646 .. 53670888
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG304400.1

Sequence Viewer

Length: 243 bp
ATGAGGCTATGGAAGGGAAAGCTTGTTAAGCATATAGGACTGGAAAGTAAAAACAATCCTAATTTAGGATTGGAACCTGATGACACTCCTCATCAAGATCTCAAGACTACAGGATTGAAGTTTGGTAACAATCCTGATACGGGATTGAGAGGCAATAGTGGTCCAAGACTAGACAATATGCAGGTCTCTGCTCACATCAGTGCCAAAGCACAACCTTATGCTCCAAGACATAGAACAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.79

Weight (kDa)

9.99

Isoelectric Point (pI)

19.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 172
AfiI CCNNNNNNNGG 2 cut(s) 65, 140
AgsI TTSAA 1 cut(s) 118
AleI CACNNNNGTG 1 cut(s) 198
AluBI AGCT 1 cut(s) 22
AluI AGCT 1 cut(s) 22
Alw26I GTCTC 1 cut(s) 190
AspS9I GGNCC 1 cut(s) 161
AvaII GGWCC 1 cut(s) 161
BcoDI GTCTC 1 cut(s) 190
BfaI CTAG 1 cut(s) 170
BfmI CTRYAG 1 cut(s) 108
BfuAI ACCTGC 1 cut(s) 172
BglII AGATCT 1 cut(s) 97
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 1 cut(s) 161
BmiI GGNNCC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 86
BsaI GGTCTC 1 cut(s) 190
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 140
Bse1I ACTGG 1 cut(s) 45
BseLI CCNNNNNNNGG 2 cut(s) 65, 140
BseNI ACTGG 1 cut(s) 45
BseRI GAGGAG 1 cut(s) 78
BslI CCNNNNNNNGG 2 cut(s) 65, 140
BsmAI GTCTC 1 cut(s) 190
Bso31I GGTCTC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 75
BspMI ACCTGC 1 cut(s) 172
BspTNI GGTCTC 1 cut(s) 190
BsrI ACTGG 1 cut(s) 45
BssMI GATC 1 cut(s) 97
BstENI CCTNNNNNAGG 1 cut(s) 63
BstKTI GATC 1 cut(s) 100
BstMAI GTCTC 1 cut(s) 190
BstMBI GATC 1 cut(s) 97
BstMWI GCNNNNNNNGC 1 cut(s) 28
BstSFI CTRYAG 1 cut(s) 108
BstX2I RGATCY 1 cut(s) 97
BstYI RGATCY 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 205
BveI ACCTGC 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 161
CviJI RGCY 2 cut(s) 7, 22
CviKI_1 RGCY 2 cut(s) 7, 22
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
Eco31I GGTCTC 1 cut(s) 190
Eco47I GGWCC 1 cut(s) 161
EcoNI CCTNNNNNAGG 1 cut(s) 63
FaiI YATR 6 cut(s) 10, 33, 35, 179, 219, 231
FspBI CTAG 1 cut(s) 170
HindIII AAGCTT 1 cut(s) 20
Hpy188III TCNNGA 3 cut(s) 95, 103, 134
HpyAV CCTTC 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 28
Kzo9I GATC 1 cut(s) 97
LmnI GCTCC 1 cut(s) 226
LpnPI CCDG 6 cut(s) 26, 90, 96, 147, 167, 222
MaeI CTAG 1 cut(s) 170
MaeIII GTNAC 1 cut(s) 125
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MflI RGATCY 1 cut(s) 97
MluCI AATT 1 cut(s) 61
MnlI CCTC 2 cut(s) 99, 143
MseI TTAA 1 cut(s) 27
MslI CAYNNNNRTG 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 28
NdeII GATC 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 75
OliI CACNNNNGTG 1 cut(s) 198
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 161
PsuI RGATCY 1 cut(s) 97
RseI CAYNNNNRTG 1 cut(s) 198
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 97
Sau96I GGNCC 1 cut(s) 161
SetI ASST 5 cut(s) 24, 79, 186, 217, 241
SfcI CTRYAG 1 cut(s) 108
SinI GGWCC 1 cut(s) 161
SmiMI CAYNNNNRTG 1 cut(s) 198
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 1 cut(s) 61
SspMI CTAG 1 cut(s) 170
TasI AATT 1 cut(s) 61
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TscAI CASTG 1 cut(s) 205
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 161
XagI CCTNNNNNAGG 1 cut(s) 63
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.