Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004598.1

Orthogroup ID

OG0003585

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 6084

Gene Structure 6084 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004598.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 567 bp

gtgaaggtcaggcaacaagaagagaaagatgatcaatatgcccttcttgatttttctactccagtgaaggacaaagatgtttctccagctactgttgcaaaagctccaaaatcttatgttccaagagtagttatgccatcgatctctgttgctgaaggagcaaagaaggccaataagattgaagagatgaataaacaaaatattagagccagctcaatccctccacctcgtgctgtcttatccagtcctgacaatgatacggtgattggaaacaaaaataggatcaaagcacaacgaccatctgctctgaagaatcatagcttggaattcgatgacactccttatcaagatctcaaaactataggattgaagtttggtgacaatccggatacgggattgagaggcaatagtggtccaaaactagacaatatgcaggtctatgcttacatcagtgccaaagcacaaccttatgctccaagacataaaacagataagattccatctgactggagcagtggagcagacaagcacaaagcaagacaaggaagagcctttgaattgtactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

188

Amino Acids

20.82

Weight (kDa)

9.52

Isoelectric Point (pI)

44.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003585)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G21865
fragaria_vesca	FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630 FvH4_4g04630
malus_domestica	MD16G1226400.v1.1
prunus_persica	Prupe.1G048400_v2.0.a1 Prupe.1G048400_v2.0.a1 Prupe.1G048400_v2.0.a1
pyrus_communis	pycom16g18960
rosa_chinensis	RchiOBHm_Chr1g0362101 RchiOBHm_Chr4g0395401
rosa_laevigata	RLG00000009625
rosa_multiflora	Rmu_sc0004598.1_g000001 Rmu_sc0010817.1_g000013
rosa_roxburghii	Rroxscaffold_5G00340360
rosa_rugosa	Rorug01G0293700 Rorug03G0357600
rosa_samantha	Rh1AG304400 Rh2BG188400 Rh4AG059600 Rh4BG058100 Rh4CG063600 Rh4DG054700 Rh6AG105300 Rh7AG389000 Rh7CG408200 Rh7DG387000
rosa_wichuraiana	Rw0G003300 Rw0G007660 Rw4G004760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	424
AccIII	TCCGGA	1 cut(s)	385
AclWI	GGATC	1 cut(s)	290
AcsI	RAATTY	1 cut(s)	326
AcuI	CTGAAG	2 cut(s)	174, 329
AdeI	CACNNNGTG	1 cut(s)	230
AfaI	GTAC	1 cut(s)	563
AfiI	CCNNNNNNNGG	1 cut(s)	392
AgsI	TTSAA	3 cut(s)	182, 370, 557
AjuI	GAANNNNNNNTTGG	2 cut(s)	305, 337
AluBI	AGCT	4 cut(s)	89, 104, 213, 321
AluI	AGCT	4 cut(s)	89, 104, 213, 321
AlwI	GGATC	1 cut(s)	290
AlwNI	CAGNNNCTG	1 cut(s)	92
Aor13HI	TCCGGA	1 cut(s)	385
AoxI	GGCC	1 cut(s)	168
ApoI	RAATTY	1 cut(s)	326
AspS9I	GGNCC	1 cut(s)	413
AsuHPI	GGTGA	2 cut(s)	274, 389
AvaII	GGWCC	1 cut(s)	413
BauI	CACGAG	1 cut(s)	228
BccI	CCATC	3 cut(s)	145, 307, 508
BciVI	GTATCC	1 cut(s)	382
BclI	TGATCA	1 cut(s)	31
BfaI	CTAG	1 cut(s)	422
BfmI	CTRYAG	1 cut(s)	360
BfuAI	ACCTGC	1 cut(s)	424
BfuI	GTATCC	1 cut(s)	382
BglII	AGATCT	1 cut(s)	349
Bme18I	GGWCC	1 cut(s)	413
BmgT120I	GGNCC	1 cut(s)	413
BpmI	CTGGAG	3 cut(s)	45, 69, 529
Bsa29I	ATCGAT	1 cut(s)	140
BsaWI	WCCGGW	1 cut(s)	385
Bsc4I	CCNNNNNNNGG	1 cut(s)	392
Bse1I	ACTGG	3 cut(s)	62, 243, 512
BseAI	TCCGGA	1 cut(s)	385
BseCI	ATCGAT	1 cut(s)	140
BseLI	CCNNNNNNNGG	1 cut(s)	392
BseNI	ACTGG	3 cut(s)	62, 243, 512
BshFI	GGCC	1 cut(s)	170
BshVI	ATCGAT	1 cut(s)	140
BsiSI	CCGG	1 cut(s)	386
BslI	CCNNNNNNNGG	1 cut(s)	392
BsnI	GGCC	1 cut(s)	170
Bsp13I	TCCGGA	1 cut(s)	385
Bsp143I	GATC	4 cut(s)	31, 141, 282, 349
BspANI	GGCC	1 cut(s)	170
BspDI	ATCGAT	1 cut(s)	140
BspEI	TCCGGA	1 cut(s)	385
BspMI	ACCTGC	1 cut(s)	424
BspPI	GGATC	1 cut(s)	290
BspQI	GCTCTTC	1 cut(s)	541
BsrI	ACTGG	3 cut(s)	62, 243, 512
BssMI	GATC	4 cut(s)	31, 141, 282, 349
BssSI	CACGAG	1 cut(s)	228
Bst2BI	CACGAG	1 cut(s)	228
Bst4CI	ACNGT	2 cut(s)	94, 262
Bst6I	CTCTTC	3 cut(s)	15, 177, 541
BstC8I	GCNNGC	1 cut(s)	211
BstKTI	GATC	4 cut(s)	34, 144, 285, 352
BstMBI	GATC	4 cut(s)	31, 141, 282, 349
BstMWI	GCNNNNNNNGC	3 cut(s)	95, 158, 167
BstSFI	CTRYAG	1 cut(s)	360
BstX2I	RGATCY	1 cut(s)	349
BstXI	CCANNNNNNTGG	1 cut(s)	507
BstYI	RGATCY	1 cut(s)	349
Bsu15I	ATCGAT	1 cut(s)	140
BsuI	GTATCC	1 cut(s)	382
BsuRI	GGCC	1 cut(s)	170
BsuTUI	ATCGAT	1 cut(s)	140
BtsI	GCAGTG	1 cut(s)	520
BtsIMutI	CAGTG	3 cut(s)	69, 457, 520
BveI	ACCTGC	1 cut(s)	424
Cac8I	GCNNGC	1 cut(s)	211
CaiI	CAGNNNCTG	1 cut(s)	92
Cfr13I	GGNCC	1 cut(s)	413
ClaI	ATCGAT	1 cut(s)	140
Csp6I	GTAC	1 cut(s)	562
CviJI	RGCY	7 cut(s)	89, 104, 170, 209, 213, 321, 551
CviKI_1	RGCY	7 cut(s)	89, 104, 170, 209, 213, 321, 551
CviQI	GTAC	1 cut(s)	562
DpnI	GATC	4 cut(s)	33, 143, 284, 351
DpnII	GATC	4 cut(s)	31, 141, 282, 349
DraIII	CACNNNGTG	1 cut(s)	230
Eam1104I	CTCTTC	3 cut(s)	15, 177, 541
EarI	CTCTTC	3 cut(s)	15, 177, 541
Eco47I	GGWCC	1 cut(s)	413
Eco57I	CTGAAG	2 cut(s)	174, 329
EcoRI	GAATTC	1 cut(s)	326
FaiI	YATR	9 cut(s)	39, 117, 134, 318, 362, 431, 441, 471, 483
FbaI	TGATCA	1 cut(s)	31
FspBI	CTAG	1 cut(s)	422
GsuI	CTGGAG	3 cut(s)	45, 69, 529
HaeIII	GGCC	1 cut(s)	170
HapII	CCGG	1 cut(s)	386
HinfI	GANTC	2 cut(s)	313, 496
HpaII	CCGG	1 cut(s)	386
HphI	GGTGA	2 cut(s)	274, 389
Hpy188I	TCNGA	2 cut(s)	309, 505
Hpy188III	TCNNGA	4 cut(s)	47, 248, 347, 386
HpyAV	CCTTC	4 cut(s)	53, 61, 149, 160
HpyCH4III	ACNGT	2 cut(s)	94, 262
HpyCH4V	TGCA	2 cut(s)	98, 433
HpyF10VI	GCNNNNNNNGC	3 cut(s)	95, 158, 167
Kpn2I	TCCGGA	1 cut(s)	385
Ksp22I	TGATCA	1 cut(s)	31
Kzo9I	GATC	4 cut(s)	31, 141, 282, 349
LguI	GCTCTTC	1 cut(s)	541
LmnI	GCTCC	5 cut(s)	109, 158, 478, 510, 518
LpnPI	CCDG	8 cut(s)	75, 99, 223, 256, 261, 399, 419, 493
MaeI	CTAG	1 cut(s)	422
MaeIII	GTNAC	1 cut(s)	377
MalI	GATC	4 cut(s)	33, 143, 284, 351
MboI	GATC	4 cut(s)	31, 141, 282, 349
MboII	GAAGA	4 cut(s)	32, 194, 322, 558
MflI	RGATCY	1 cut(s)	349
MluCI	AATT	2 cut(s)	326, 557
MnlI	CCTC	3 cut(s)	231, 237, 395
MroI	TCCGGA	1 cut(s)	385
MspI	CCGG	1 cut(s)	386
MwoI	GCNNNNNNNGC	3 cut(s)	95, 158, 167
NdeII	GATC	4 cut(s)	31, 141, 282, 349
NmuCI	GTSAC	1 cut(s)	377
PciSI	GCTCTTC	1 cut(s)	541
PfeI	GAWTC	2 cut(s)	313, 496
PspPI	GGNCC	1 cut(s)	413
PstNI	CAGNNNCTG	1 cut(s)	92
PsuI	RGATCY	1 cut(s)	349
RsaI	GTAC	1 cut(s)	563
RsaNI	GTAC	1 cut(s)	562
SapI	GCTCTTC	1 cut(s)	541
Sau3AI	GATC	4 cut(s)	31, 141, 282, 349
Sau96I	GGNCC	1 cut(s)	413
SetI	ASST	8 cut(s)	9, 91, 106, 215, 229, 323, 438, 469
SfcI	CTRYAG	1 cut(s)	360
SinI	GGWCC	1 cut(s)	413
Sse9I	AATT	2 cut(s)	326, 557
SspI	AATATT	1 cut(s)	202
SspMI	CTAG	1 cut(s)	422
TaaI	ACNGT	2 cut(s)	94, 262
TaqI	TCGA	2 cut(s)	140, 330
TasI	AATT	2 cut(s)	326, 557
TatI	WGTACW	1 cut(s)	561
TfiI	GAWTC	2 cut(s)	313, 496
TscAI	CASTG	3 cut(s)	69, 457, 520
TseFI	GTSAC	1 cut(s)	377
Tsp45I	GTSAC	1 cut(s)	377
TspDTI	ATGAA	1 cut(s)	203
TspRI	CASTG	3 cut(s)	69, 457, 520
VpaK11BI	GGWCC	1 cut(s)	413
XapI	RAATTY	1 cut(s)	326
XspI	CTAG	1 cut(s)	422

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.