Rh7CG408200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
52402367 .. 52402648
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG408200.1

Sequence Viewer

Length: 282 bp
ATGGTGTTACTTGTTAAGGATATAGGACTGGAAAGTAAAAACAATCCTAATTTAGGATTGGAACCCGATGACACTCCTTATCAAGATCTCAAGACTATGGGATTGAAGTTTGGTAACAATCCTGATACCGGATTGAGAGGCAATAGTGGTCCAAGACTAGACGATATGCAGGCCTCTGCTCACATCAGTGCCAAAGCACAACCTTATGCTCCAAGACATAAGATTCCATCTGACTGGAGCAGTGGAGCAGACGCTCAAAGCAAGACAAGGAGGAGCCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.1

Weight (kDa)

8.05

Isoelectric Point (pI)

36.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 53, 128
AgsI TTSAA 1 cut(s) 106
AleI CACNNNNGTG 1 cut(s) 186
AoxI GGCC 1 cut(s) 171
AspS9I GGNCC 1 cut(s) 149
AvaII GGWCC 1 cut(s) 149
BccI CCATC 1 cut(s) 235
BfaI CTAG 1 cut(s) 158
BglII AGATCT 1 cut(s) 85
Bme18I GGWCC 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 149
BmiI GGNNCC 2 cut(s) 63, 275
BpmI CTGGAG 1 cut(s) 256
BpuEI CTTGAG 1 cut(s) 74
BsaWI WCCGGW 1 cut(s) 128
Bsc4I CCNNNNNNNGG 2 cut(s) 53, 128
Bse1I ACTGG 2 cut(s) 33, 239
BseLI CCNNNNNNNGG 2 cut(s) 53, 128
BseNI ACTGG 2 cut(s) 33, 239
BshFI GGCC 1 cut(s) 173
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 2 cut(s) 53, 128
BsnI GGCC 1 cut(s) 173
Bsp143I GATC 1 cut(s) 85
BspANI GGCC 1 cut(s) 173
BspLI GGNNCC 2 cut(s) 63, 275
BsrI ACTGG 2 cut(s) 33, 239
BssMI GATC 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 171
BstENI CCTNNNNNAGG 1 cut(s) 51
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstX2I RGATCY 1 cut(s) 85
BstXI CCANNNNNNTGG 1 cut(s) 234
BstYI RGATCY 1 cut(s) 85
BsuRI GGCC 1 cut(s) 173
BtsI GCAGTG 1 cut(s) 247
BtsIMutI CAGTG 2 cut(s) 193, 247
Cac8I GCNNGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 149
CseI GACGC 1 cut(s) 260
CviJI RGCY 2 cut(s) 173, 276
CviKI_1 RGCY 2 cut(s) 173, 276
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eco147I AGGCCT 1 cut(s) 173
Eco47I GGWCC 1 cut(s) 149
EcoNI CCTNNNNNAGG 1 cut(s) 51
FaiI YATR 5 cut(s) 23, 98, 167, 207, 219
FspBI CTAG 1 cut(s) 158
GsuI CTGGAG 1 cut(s) 256
HaeIII GGCC 1 cut(s) 173
HapII CCGG 1 cut(s) 129
HgaI GACGC 1 cut(s) 260
HinfI GANTC 1 cut(s) 223
HpaII CCGG 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 232
Hpy188III TCNNGA 3 cut(s) 83, 91, 122
HpyCH4V TGCA 1 cut(s) 169
Kzo9I GATC 1 cut(s) 85
LmnI GCTCC 4 cut(s) 214, 237, 245, 273
LpnPI CCDG 5 cut(s) 14, 135, 142, 155, 220
MaeI CTAG 1 cut(s) 158
MaeIII GTNAC 2 cut(s) 6, 113
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MflI RGATCY 1 cut(s) 85
MluCI AATT 1 cut(s) 49
MnlI CCTC 3 cut(s) 131, 184, 264
MseI TTAA 1 cut(s) 15
MslI CAYNNNNRTG 1 cut(s) 186
MspI CCGG 1 cut(s) 129
NdeII GATC 1 cut(s) 85
NlaIV GGNNCC 2 cut(s) 63, 275
OliI CACNNNNGTG 1 cut(s) 186
PceI AGGCCT 1 cut(s) 173
PfeI GAWTC 1 cut(s) 223
PspN4I GGNNCC 2 cut(s) 63, 275
PspPI GGNCC 1 cut(s) 149
PsuI RGATCY 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 186
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 1 cut(s) 85
Sau96I GGNCC 1 cut(s) 149
SetI ASST 1 cut(s) 205
SinI GGWCC 1 cut(s) 149
SmiMI CAYNNNNRTG 1 cut(s) 186
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 1 cut(s) 49
SseBI AGGCCT 1 cut(s) 173
SspMI CTAG 1 cut(s) 158
StuI AGGCCT 1 cut(s) 173
TasI AATT 1 cut(s) 49
TfiI GAWTC 1 cut(s) 223
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TscAI CASTG 2 cut(s) 193, 247
TspRI CASTG 2 cut(s) 193, 247
VpaK11BI GGWCC 1 cut(s) 149
XagI CCTNNNNNAGG 1 cut(s) 51
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.