Rh2BG188400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
16935714 .. 16936070
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG188400.1

Sequence Viewer

Length: 357 bp
ATGCTTTATTCATCTGCATTTATCACTGTTAAGAATATAGGACTGGAAAGTAAATACAATCCTAATTTAGGATTGGAATTCGATGACACTCCTTATCAAGATTTCAAACCTACAGGATTGAAGTTTGGTAACAATCCTGATACGGGATTGAGAGGCAATACTGATCCAAGACTAGACAATATGCAGGTCTCTGCTCACATCAGTGTCAAAGCACAACCTTATGCTCCTGATGTAAATGTGATATTGAACTTAGAGAAGAAATACACAAGAAATTCTCTCAAAACACTCATGTTGTTTACATTCTATCAATCACAGTCTGCACAACAGAACCACAAAACAAAATCTTCAAGGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.36

Weight (kDa)

9.36

Isoelectric Point (pI)

36.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 175
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 2 cut(s) 77, 271
AfiI CCNNNNNNNGG 2 cut(s) 68, 143
AgsI TTSAA 4 cut(s) 106, 121, 247, 348
AleI CACNNNNGTG 1 cut(s) 201
Alw26I GTCTC 1 cut(s) 193
AlwI GGATC 1 cut(s) 158
ApoI RAATTY 2 cut(s) 77, 271
BcoDI GTCTC 1 cut(s) 193
BfaI CTAG 1 cut(s) 173
BfmI CTRYAG 1 cut(s) 111
BfuAI ACCTGC 1 cut(s) 175
BsaI GGTCTC 1 cut(s) 193
Bsc4I CCNNNNNNNGG 2 cut(s) 68, 143
Bse1I ACTGG 1 cut(s) 48
BseLI CCNNNNNNNGG 2 cut(s) 68, 143
BseNI ACTGG 1 cut(s) 48
BsgI GTGCAG 1 cut(s) 303
BslI CCNNNNNNNGG 2 cut(s) 68, 143
BsmAI GTCTC 1 cut(s) 193
Bso31I GGTCTC 1 cut(s) 193
Bsp143I GATC 1 cut(s) 163
BspMI ACCTGC 1 cut(s) 175
BspPI GGATC 1 cut(s) 158
BspTNI GGTCTC 1 cut(s) 193
BsrI ACTGG 1 cut(s) 48
BssMI GATC 1 cut(s) 163
Bst4CI ACNGT 2 cut(s) 28, 315
BstDEI CTNAG 1 cut(s) 250
BstENI CCTNNNNNAGG 1 cut(s) 66
BstKTI GATC 1 cut(s) 166
BstMAI GTCTC 1 cut(s) 193
BstMBI GATC 1 cut(s) 163
BstSFI CTRYAG 1 cut(s) 111
BtsIMutI CAGTG 2 cut(s) 24, 208
BveI ACCTGC 1 cut(s) 175
CviAII CATG 1 cut(s) 289
DdeI CTNAG 1 cut(s) 250
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eco31I GGTCTC 1 cut(s) 193
EcoNI CCTNNNNNAGG 1 cut(s) 66
EcoRI GAATTC 1 cut(s) 77
FaeI CATG 1 cut(s) 292
FaiI YATR 4 cut(s) 38, 182, 222, 290
FatI CATG 1 cut(s) 288
FspBI CTAG 1 cut(s) 173
Hin1II CATG 1 cut(s) 292
Hpy166II GTNNAC 1 cut(s) 297
Hpy188III TCNNGA 3 cut(s) 98, 137, 227
Hpy8I GTNNAC 1 cut(s) 297
HpyCH4III ACNGT 2 cut(s) 28, 315
HpyCH4V TGCA 3 cut(s) 17, 184, 320
HpyF3I CTNAG 1 cut(s) 250
Hsp92II CATG 1 cut(s) 292
Kzo9I GATC 1 cut(s) 163
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 5 cut(s) 29, 99, 150, 170, 240
MaeI CTAG 1 cut(s) 173
MaeIII GTNAC 1 cut(s) 128
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 2 cut(s) 268, 336
MluCI AATT 3 cut(s) 64, 77, 271
MnlI CCTC 1 cut(s) 146
MseI TTAA 1 cut(s) 30
MslI CAYNNNNRTG 1 cut(s) 201
NdeII GATC 1 cut(s) 163
NlaIII CATG 1 cut(s) 292
OliI CACNNNNGTG 1 cut(s) 201
RseI CAYNNNNRTG 1 cut(s) 201
SaqAI TTAA 1 cut(s) 30
Sau3AI GATC 1 cut(s) 163
SetI ASST 3 cut(s) 112, 189, 220
SfcI CTRYAG 1 cut(s) 111
SmiMI CAYNNNNRTG 1 cut(s) 201
Sse9I AATT 3 cut(s) 64, 77, 271
SspMI CTAG 1 cut(s) 173
TaaI ACNGT 2 cut(s) 28, 315
TaqI TCGA 1 cut(s) 81
TasI AATT 3 cut(s) 64, 77, 271
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TscAI CASTG 2 cut(s) 31, 208
TspRI CASTG 2 cut(s) 31, 208
XagI CCTNNNNNAGG 1 cut(s) 66
XapI RAATTY 2 cut(s) 77, 271
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.