RchiOBHm_Chr2g0095631

beta-galactosidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0015734
Physical Location & Seq
Reverse (-)
8558099 .. 8558841
743 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47060

Sequence Viewer

Length: 255 bp
ATGAAAACGATTCAAGATGAAGGACTGTATGCTGTTCTTCGGATTGGTCCATATAATGAGATGAAGAATTTCACTACATTGATGGTGGATATGATGAAAAAAGAGAAACTATTTGCATCTCAAGGAGGCCCTATCATTATGGCTCAGATTGAAAATGAATATGGGAATGTGGAATCATACCATGGAGATGCTGGAAAAGCATACATTAACTGGTCTGCAAATGTTGCTGAATTACTAAACATCGGAGTTCCATGA

Protein Analysis

84

Amino Acids

9.37

Weight (kDa)

4.94

Isoelectric Point (pI)

28.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_35 PF01301 20 - 84 1.7e-12 Glycosyl hydrolases family 35
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 67
AgsI TTSAA 2 cut(s) 14, 152
AoxI GGCC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 67
Asp700I GAANNNNTTC 1 cut(s) 68
AspS9I GGNCC 2 cut(s) 47, 128
AvaII GGWCC 1 cut(s) 47
BccI CCATC 1 cut(s) 76
Bme18I GGWCC 1 cut(s) 47
BmgT120I GGNCC 2 cut(s) 47, 128
BmsI GCATC 2 cut(s) 125, 178
BpuEI CTTGAG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 215
BseDI CCNNGG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 158
BseNI ACTGG 1 cut(s) 215
BshFI GGCC 1 cut(s) 129
BsnI GGCC 1 cut(s) 129
Bsp19I CCATGG 1 cut(s) 181
BspANI GGCC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 157
BsrI ACTGG 1 cut(s) 215
BssECI CCNNGG 1 cut(s) 181
BssT1I CCWWGG 1 cut(s) 181
Bst4CI ACNGT 1 cut(s) 27
BstAPI GCANNNNNTGC 1 cut(s) 224
BstDEI CTNAG 1 cut(s) 144
BstDSI CCRYGG 1 cut(s) 181
BstMWI GCNNNNNNNGC 2 cut(s) 197, 224
BsuRI GGCC 1 cut(s) 129
BtgI CCRYGG 1 cut(s) 181
Cfr13I GGNCC 2 cut(s) 47, 128
CviAII CATG 2 cut(s) 182, 252
CviJI RGCY 2 cut(s) 129, 143
CviKI_1 RGCY 2 cut(s) 129, 143
DdeI CTNAG 1 cut(s) 144
Eco130I CCWWGG 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 47
EcoO109I RGGNCCY 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
FaeI CATG 2 cut(s) 185, 255
FatI CATG 2 cut(s) 181, 251
HaeIII GGCC 1 cut(s) 129
Hin1II CATG 2 cut(s) 185, 255
HinfI GANTC 2 cut(s) 10, 173
Hpy188I TCNGA 3 cut(s) 42, 147, 245
Hpy188III TCNNGA 1 cut(s) 14
HpyAV CCTTC 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 27
HpyCH4V TGCA 2 cut(s) 116, 218
HpyF10VI GCNNNNNNNGC 2 cut(s) 197, 224
HpyF3I CTNAG 1 cut(s) 144
Hsp92II CATG 2 cut(s) 185, 255
LpnPI CCDG 2 cut(s) 177, 196
LweI GCATC 2 cut(s) 125, 178
MboII GAAGA 2 cut(s) 29, 76
MluCI AATT 2 cut(s) 67, 230
MnlI CCTC 1 cut(s) 119
MroXI GAANNNNTTC 1 cut(s) 68
MseI TTAA 1 cut(s) 207
MslI CAYNNNNRTG 1 cut(s) 186
MwoI GCNNNNNNNGC 2 cut(s) 197, 224
NcoI CCATGG 1 cut(s) 181
NlaIII CATG 2 cut(s) 185, 255
PdmI GAANNNNTTC 1 cut(s) 68
PfeI GAWTC 2 cut(s) 10, 173
PspPI GGNCC 2 cut(s) 47, 128
RseI CAYNNNNRTG 1 cut(s) 186
SaqAI TTAA 1 cut(s) 207
Sau96I GGNCC 2 cut(s) 47, 128
SfaNI GCATC 2 cut(s) 125, 178
SgeI CNNG 5 cut(s) 26, 134, 194, 204, 223
SinI GGWCC 1 cut(s) 47
SmiMI CAYNNNNRTG 1 cut(s) 186
SmlI CTYRAG 1 cut(s) 120
SmoI CTYRAG 1 cut(s) 120
Sse9I AATT 2 cut(s) 67, 230
StyI CCWWGG 1 cut(s) 181
TaaI ACNGT 1 cut(s) 27
TasI AATT 2 cut(s) 67, 230
TfiI GAWTC 2 cut(s) 10, 173
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TspDTI ATGAA 5 cut(s) 17, 33, 77, 110, 171
VpaK11BI GGWCC 1 cut(s) 47
XapI RAATTY 1 cut(s) 67
XcmI CCANNNNNNNNNTGG 1 cut(s) 188
XmnI GAANNNNTTC 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.