RchiOBHm_Chr2g0096241

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
9047763 .. 9050488
2726 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47120

Sequence Viewer

Length: 237 bp
ATGCCTGGGAGTTTAGCAGAGAGAGAGATATCCAGCAGTGGCATGATTTCTGGGTTTTGGGTTAAGGTTGATTGGGATGAATTGATGGCTAGGGGTTCAGAGATAGAGCTTGATCTCTTGCTTGATGTTTCTGGGTTGTTGTGGCTTGCTTCCAACGGTGATGAACCTGCTTTTTATAGTGGAGATAGGAGGGGAAGATTCGTGCTAAGAATCGGGGTTTTGAAGTGGTATTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.75

Weight (kDa)

4.58

Isoelectric Point (pI)

47.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 175
AgsI TTSAA 1 cut(s) 223
AjnI CCWGG 1 cut(s) 4
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 170
BccI CCATC 1 cut(s) 79
BciT130I CCWGG 1 cut(s) 6
BfaI CTAG 1 cut(s) 90
BfuAI ACCTGC 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 5
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 5
BseGI GGATG 1 cut(s) 82
Bsp143I GATC 1 cut(s) 112
BspMI ACCTGC 1 cut(s) 175
BssECI CCNNGG 1 cut(s) 5
BssMI GATC 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 2 cut(s) 206, 234
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstNI CCWGG 1 cut(s) 6
BstSCI CCNGG 1 cut(s) 4
BtsCI GGATG 1 cut(s) 82
BtsI GCAGTG 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 43
BveI ACCTGC 1 cut(s) 175
Cac8I GCNNGC 1 cut(s) 147
CviAII CATG 1 cut(s) 43
CviJI RGCY 3 cut(s) 89, 109, 145
CviKI_1 RGCY 3 cut(s) 89, 109, 145
DdeI CTNAG 2 cut(s) 206, 234
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco32I GATATC 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 4
EcoRV GATATC 1 cut(s) 30
FaeI CATG 1 cut(s) 46
FaiI YATR 2 cut(s) 44, 177
FatI CATG 1 cut(s) 42
FokI GGATG 1 cut(s) 89
FspBI CTAG 1 cut(s) 90
Hin1II CATG 1 cut(s) 46
HinfI GANTC 2 cut(s) 198, 210
HphI GGTGA 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 100
HpyCH4III ACNGT 1 cut(s) 158
HpyF3I CTNAG 2 cut(s) 206, 234
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 5 cut(s) 18, 36, 46, 117, 180
MaeI CTAG 1 cut(s) 90
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 1 cut(s) 207
MluCI AATT 1 cut(s) 80
MmeI TCCRAC 1 cut(s) 177
MnlI CCTC 1 cut(s) 183
MseI TTAA 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 46
PfeI GAWTC 2 cut(s) 198, 210
Psp6I CCWGG 1 cut(s) 4
PspGI CCWGG 1 cut(s) 4
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 6
SetI ASST 3 cut(s) 69, 111, 169
Sse9I AATT 1 cut(s) 80
SspMI CTAG 1 cut(s) 90
StyD4I CCNGG 1 cut(s) 4
TaaI ACNGT 1 cut(s) 158
TasI AATT 1 cut(s) 80
TfiI GAWTC 2 cut(s) 198, 210
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 2 cut(s) 93, 177
TspRI CASTG 1 cut(s) 43
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.