Rh4CG004300

Serine aminopeptidase, S33

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
817668 .. 817904
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG004300.1

Sequence Viewer

Length: 237 bp
ATGGTCCATGGCTACGGCAACGACATCAGCTGGACTTTTCAGGCCACAGCCATCTTCCTCTCCCAGAATGGCTTCGCCTGCTTCGTTCTTGACATCGAATCCCACAGCCGGTCCCACCGCCTCAAAGCCTTCGTCTCAAATGTCGATTTGGTCGTCCCACAGCCACAGCCGGTTCTTCTTCAATTTCGTCAAGCAAAACCTCCAACAGGAAACCTTACCGTCCTTCCTCTACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.68

Weight (kDa)

8.0

Isoelectric Point (pI)

46.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 118
AfiI CCNNNNNNNGG 2 cut(s) 108, 206
AgsI TTSAA 1 cut(s) 182
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
Alw26I GTCTC 1 cut(s) 139
AoxI GGCC 1 cut(s) 42
ArsI GACNNNNNNTTYG 2 cut(s) 117, 149
Asp700I GAANNNNTTC 1 cut(s) 71
AspS9I GGNCC 2 cut(s) 4, 111
AvaII GGWCC 2 cut(s) 4, 111
BccI CCATC 1 cut(s) 59
BceAI ACGGC 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 139
Bme18I GGWCC 2 cut(s) 4, 111
BmgT120I GGNCC 2 cut(s) 4, 111
BmiI GGNNCC 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 7
Bsc4I CCNNNNNNNGG 2 cut(s) 108, 206
Bse118I RCCGGY 2 cut(s) 108, 169
BseDI CCNNGG 1 cut(s) 7
BseLI CCNNNNNNNGG 2 cut(s) 108, 206
BshFI GGCC 1 cut(s) 44
BsiSI CCGG 2 cut(s) 109, 170
BslFI GGGAC 2 cut(s) 97, 140
BslI CCNNNNNNNGG 2 cut(s) 108, 206
BsmAI GTCTC 1 cut(s) 139
BsmBI CGTCTC 1 cut(s) 139
BsmFI GGGAC 2 cut(s) 97, 140
BsnI GGCC 1 cut(s) 44
Bsp19I CCATGG 1 cut(s) 7
BspACI CCGC 1 cut(s) 118
BspANI GGCC 1 cut(s) 44
BspLI GGNNCC 1 cut(s) 113
BsrFI RCCGGY 2 cut(s) 108, 169
BssAI RCCGGY 2 cut(s) 108, 169
BssECI CCNNGG 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 7
Bst4CI ACNGT 2 cut(s) 220, 234
BstC8I GCNNGC 1 cut(s) 79
BstDSI CCRYGG 1 cut(s) 7
BstENI CCTNNNNNAGG 1 cut(s) 204
BstMAI GTCTC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 7
Cac8I GCNNGC 1 cut(s) 79
Cfr10I RCCGGY 2 cut(s) 108, 169
Cfr13I GGNCC 2 cut(s) 4, 111
CviAII CATG 1 cut(s) 8
CviJI RGCY 9 cut(s) 12, 30, 44, 50, 72, 108, 128, 163, 169
CviKI_1 RGCY 9 cut(s) 12, 30, 44, 50, 72, 108, 128, 163, 169
Eco130I CCWWGG 1 cut(s) 7
Eco47I GGWCC 2 cut(s) 4, 111
EcoNI CCTNNNNNAGG 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
Esp3I CGTCTC 1 cut(s) 139
FaeI CATG 1 cut(s) 11
FaiI YATR 1 cut(s) 9
FaqI GGGAC 2 cut(s) 97, 140
FatI CATG 1 cut(s) 7
HaeIII GGCC 1 cut(s) 44
HapII CCGG 2 cut(s) 109, 170
Hin1II CATG 1 cut(s) 11
HinfI GANTC 1 cut(s) 98
HpaII CCGG 2 cut(s) 109, 170
Hpy188III TCNNGA 1 cut(s) 89
HpyAV CCTTC 2 cut(s) 139, 233
HpyCH4III ACNGT 2 cut(s) 220, 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
Hsp92II CATG 1 cut(s) 11
LpnPI CCDG 7 cut(s) 16, 26, 77, 91, 122, 183, 192
MboII GAAGA 3 cut(s) 46, 167, 170
MluCI AATT 1 cut(s) 182
MmeI TCCRAC 1 cut(s) 227
MnlI CCTC 4 cut(s) 68, 131, 210, 237
MroXI GAANNNNTTC 1 cut(s) 71
MspA1I CMGCKG 1 cut(s) 30
MspI CCGG 2 cut(s) 109, 170
MwoI GCNNNNNNNGC 1 cut(s) 78
NcoI CCATGG 1 cut(s) 7
NlaIII CATG 1 cut(s) 11
NlaIV GGNNCC 1 cut(s) 113
PcsI WCGNNNNNNNCGW 2 cut(s) 81, 150
PdmI GAANNNNTTC 1 cut(s) 71
PfeI GAWTC 1 cut(s) 98
PspN4I GGNNCC 1 cut(s) 113
PspPI GGNCC 2 cut(s) 4, 111
PvuII CAGCTG 1 cut(s) 30
Sau96I GGNCC 2 cut(s) 4, 111
SetI ASST 3 cut(s) 32, 202, 216
SinI GGWCC 2 cut(s) 4, 111
Sse9I AATT 1 cut(s) 182
SsiI CCGC 1 cut(s) 118
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 2 cut(s) 220, 234
TaqI TCGA 2 cut(s) 96, 144
TasI AATT 1 cut(s) 182
TfiI GAWTC 1 cut(s) 98
VpaK11BI GGWCC 2 cut(s) 4, 111
XagI CCTNNNNNAGG 1 cut(s) 204
XmnI GAANNNNTTC 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.