RchiOBHm_Chr2g0170991

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
84703307 .. 84703926
620 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53847

Sequence Viewer

Length: 213 bp
ATGGCTAGGGATTCAGAGATAGGGCTTGATCTCTTACTTGATGTTTCTGGGCTGTTGTGGCTTTTGTTCTTCTTGTGGGAGAGTTGCTTGGGCTGTTTTGTAGTTAGCTTGTGCCTCCCTGCCTCTCCGCCCCTCCACAGCAGCTATAACCATCGATTTATAGAGTGGTGGTGGCTTAGGTCTGCTGCTGTTCCAGAAATCTTGCTGCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.06

Weight (kDa)

4.69

Isoelectric Point (pI)

84.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 128
AluBI AGCT 2 cut(s) 108, 144
AluI AGCT 2 cut(s) 108, 144
ApeKI GCWGC 3 cut(s) 141, 185, 205
BbvI GCAGC 3 cut(s) 153, 172, 192
BccI CCATC 1 cut(s) 159
BfaI CTAG 1 cut(s) 6
BisI GCNGC 3 cut(s) 142, 186, 206
BlsI GCNGC 3 cut(s) 143, 187, 207
Bpu10I CCTNAGC 1 cut(s) 176
Bsa29I ATCGAT 1 cut(s) 154
BseCI ATCGAT 1 cut(s) 154
BseXI GCAGC 3 cut(s) 153, 172, 192
BshVI ATCGAT 1 cut(s) 154
Bsp143I GATC 1 cut(s) 28
BspACI CCGC 1 cut(s) 128
BspDI ATCGAT 1 cut(s) 154
BssMI GATC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 176
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstV1I GCAGC 3 cut(s) 153, 172, 192
Bsu15I ATCGAT 1 cut(s) 154
BsuTUI ATCGAT 1 cut(s) 154
ClaI ATCGAT 1 cut(s) 154
CviJI RGCY 8 cut(s) 5, 25, 52, 61, 93, 108, 144, 175
CviKI_1 RGCY 8 cut(s) 5, 25, 52, 61, 93, 108, 144, 175
DdeI CTNAG 1 cut(s) 176
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
EciI GGCGGA 1 cut(s) 117
FaiI YATR 2 cut(s) 147, 161
Fnu4HI GCNGC 3 cut(s) 142, 186, 206
Fsp4HI GCNGC 3 cut(s) 142, 186, 206
FspBI CTAG 1 cut(s) 6
GluI GCNGC 3 cut(s) 142, 186, 206
HinfI GANTC 1 cut(s) 11
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
HpyF3I CTNAG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 33, 132, 207
Lsp1109I GCAGC 3 cut(s) 153, 172, 192
MaeI CTAG 1 cut(s) 6
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 1 cut(s) 61
MnlI CCTC 3 cut(s) 125, 133, 143
MwoI GCNNNNNNNGC 1 cut(s) 58
NdeII GATC 1 cut(s) 28
PfeI GAWTC 1 cut(s) 11
PkrI GCNGC 3 cut(s) 143, 187, 207
SatI GCNGC 3 cut(s) 142, 186, 206
Sau3AI GATC 1 cut(s) 28
SetI ASST 3 cut(s) 110, 146, 182
SgeI CNNG 9 cut(s) 18, 38, 50, 60, 85, 100, 121, 131, 206
SsiI CCGC 1 cut(s) 128
SspMI CTAG 1 cut(s) 6
TaqI TCGA 1 cut(s) 154
TfiI GAWTC 1 cut(s) 11
TseI GCWGC 3 cut(s) 141, 185, 205
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.