RchiOBHm_Chr2g0146631

Branched-chain-amino-acid aminotransferase-like protein 3

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
64258146 .. 64259080
935 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51634

Sequence Viewer

Length: 390 bp
ATGTTTTTATTTATTGTGAATATACTTGGTGCTTTTGTTGTTGATTTACTTTCTATTGTTTGCTTTGTTGAAGATTCATTGGAGGTTGGAAATGTCGAGGATTTTAAGGTTCATGTGTTCAAATCATCATCTGAGTTGCTTGAAAAGCTTCATGAGAAGTGGAGCAAAGTAGGAAAGAAACCATACCCAGCCATGTATTCCAGCATTAATGGTGGAATCATTCTTGATCCAGCTTTGATGGTGATTCCAATAGACGATCACAGGATTGCTGATGAGAATCGCACCAGGCTACTTGTACTGCTCATATTGAAGCTTGATGCATCAGACTATCAGAGTTTGAGGATGGGGCCAATGATCATGCGTTCAATACTTGATCGGAAGTCAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.61

Weight (kDa)

5.88

Isoelectric Point (pI)

29.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 221
AfaI GTAC 1 cut(s) 297
AgsI TTSAA 5 cut(s) 71, 121, 143, 310, 366
AjnI CCWGG 1 cut(s) 284
AluBI AGCT 4 cut(s) 148, 233, 313, 387
AluI AGCT 4 cut(s) 148, 233, 313, 387
AlwI GGATC 1 cut(s) 221
AoxI GGCC 1 cut(s) 347
AseI ATTAAT 1 cut(s) 207
Asp700I GAANNNNTTC 1 cut(s) 147
AspS9I GGNCC 1 cut(s) 347
AsuHPI GGTGA 1 cut(s) 253
BccI CCATC 2 cut(s) 232, 337
BciT130I CCWGG 1 cut(s) 286
BclI TGATCA 1 cut(s) 354
Bme1390I CCNGG 1 cut(s) 286
BmgT120I GGNCC 1 cut(s) 347
BmiI GGNNCC 1 cut(s) 348
BmrFI CCNGG 1 cut(s) 286
BmsI GCATC 2 cut(s) 307, 329
BsaBI GATNNNNATC 1 cut(s) 276
Bse8I GATNNNNATC 1 cut(s) 276
BseBI CCWGG 1 cut(s) 286
BseGI GGATG 1 cut(s) 348
BseJI GATNNNNATC 1 cut(s) 276
BseMII CTCAG 1 cut(s) 123
BseYI CCCAGC 1 cut(s) 187
BshFI GGCC 1 cut(s) 349
BsnI GGCC 1 cut(s) 349
Bsp143I GATC 4 cut(s) 226, 256, 354, 373
BspANI GGCC 1 cut(s) 349
BspCNI CTCAG 1 cut(s) 124
BspHI TCATGA 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 348
BspPI GGATC 1 cut(s) 221
BssMI GATC 4 cut(s) 226, 256, 354, 373
Bst2UI CCWGG 1 cut(s) 286
BstDEI CTNAG 1 cut(s) 132
BstF5I GGATG 1 cut(s) 348
BstKTI GATC 4 cut(s) 229, 259, 357, 376
BstMBI GATC 4 cut(s) 226, 256, 354, 373
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 286
BstSCI CCNGG 1 cut(s) 284
BsuRI GGCC 1 cut(s) 349
BtsCI GGATG 1 cut(s) 348
CciI TCATGA 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 347
Csp6I GTAC 1 cut(s) 296
CviAII CATG 4 cut(s) 113, 152, 193, 358
CviJI RGCY 7 cut(s) 148, 191, 233, 289, 313, 349, 387
CviKI_1 RGCY 7 cut(s) 148, 191, 233, 289, 313, 349, 387
CviQI GTAC 1 cut(s) 296
DdeI CTNAG 1 cut(s) 132
DpnI GATC 4 cut(s) 228, 258, 356, 375
DpnII GATC 4 cut(s) 226, 256, 354, 373
EcoRII CCWGG 1 cut(s) 284
EcoT22I ATGCAT 1 cut(s) 322
FaeI CATG 4 cut(s) 116, 155, 196, 361
FaiI YATR 7 cut(s) 23, 114, 153, 184, 194, 305, 359
FatI CATG 4 cut(s) 112, 151, 192, 357
FbaI TGATCA 1 cut(s) 354
FokI GGATG 1 cut(s) 355
GsaI CCCAGC 1 cut(s) 191
HaeIII GGCC 1 cut(s) 349
Hin1II CATG 4 cut(s) 116, 155, 196, 361
HindIII AAGCTT 2 cut(s) 146, 311
HinfI GANTC 4 cut(s) 74, 216, 244, 277
HphI GGTGA 1 cut(s) 253
Hpy188I TCNGA 4 cut(s) 133, 325, 333, 378
Hpy188III TCNNGA 2 cut(s) 152, 224
HpyCH4V TGCA 1 cut(s) 320
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 132
Hsp92II CATG 4 cut(s) 116, 155, 196, 361
Ksp22I TGATCA 1 cut(s) 354
Kzo9I GATC 4 cut(s) 226, 256, 354, 373
LmnI GCTCC 1 cut(s) 162
LpnPI CCDG 6 cut(s) 201, 214, 243, 247, 271, 298
LweI GCATC 2 cut(s) 307, 329
MalI GATC 4 cut(s) 228, 258, 356, 375
MboI GATC 4 cut(s) 226, 256, 354, 373
MboII GAAGA 1 cut(s) 83
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 3 cut(s) 76, 91, 333
Mph1103I ATGCAT 1 cut(s) 322
MroXI GAANNNNTTC 1 cut(s) 147
MseI TTAA 2 cut(s) 105, 207
MspR9I CCNGG 1 cut(s) 286
MvaI CCWGG 1 cut(s) 286
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 4 cut(s) 226, 256, 354, 373
NlaIII CATG 4 cut(s) 116, 155, 196, 361
NlaIV GGNNCC 1 cut(s) 348
NsiI ATGCAT 1 cut(s) 322
PagI TCATGA 1 cut(s) 151
PdmI GAANNNNTTC 1 cut(s) 147
PfeI GAWTC 4 cut(s) 74, 216, 244, 277
PshBI ATTAAT 1 cut(s) 207
Psp6I CCWGG 1 cut(s) 284
PspFI CCCAGC 1 cut(s) 187
PspGI CCWGG 1 cut(s) 284
PspN4I GGNNCC 1 cut(s) 348
PspPI GGNCC 1 cut(s) 347
RsaI GTAC 1 cut(s) 297
RsaNI GTAC 1 cut(s) 296
SaqAI TTAA 2 cut(s) 105, 207
Sau3AI GATC 4 cut(s) 226, 256, 354, 373
Sau96I GGNCC 1 cut(s) 347
ScrFI CCNGG 1 cut(s) 286
SetI ASST 6 cut(s) 87, 111, 150, 235, 315, 389
SfaNI GCATC 2 cut(s) 307, 329
StyD4I CCNGG 1 cut(s) 284
TaqI TCGA 1 cut(s) 96
TatI WGTACW 1 cut(s) 295
TfiI GAWTC 4 cut(s) 74, 216, 244, 277
Tru1I TTAA 2 cut(s) 105, 207
Tru9I TTAA 2 cut(s) 105, 207
TspDTI ATGAA 3 cut(s) 66, 101, 140
VspI ATTAAT 1 cut(s) 207
XmnI GAANNNNTTC 1 cut(s) 147
Zsp2I ATGCAT 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.