Rh1CG108200

Branched-chain-amino-acid aminotransferase-like protein 3

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
21914740 .. 21917161
2422 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG108200.1

Sequence Viewer

Length: 372 bp
ATGTTTTTATTTATTGTGAATATACTTGGTGCTTTTGTTGTTGATTTACTTTCTATTGTTTGCTTTGTTGAAGATTCATTGGAGGTTGGAAATGTCGAGGATTTTAAGGTTCATGTGTTCAAATCATCATCTGAGTTGCTTGAAAAGCTTCATGAGAAGTGGAGCAAAGTAGGAAAGAAACCATACCCAGCCATGTATTCCAGCATTAATGGTGGAATCATTCTTGATCCAGCTTTGATGAAGATAATTGTAGAGCTGAGATTGAAGCTTGAAGCAACTACATATGGCAATGTTTCATCTGTTGGCATACTTCTGGTTCTCTCAAGTTCTTCTCCTGAAATACTCACCGGTCTAGATCACGACAAACCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.54

Weight (kDa)

5.28

Isoelectric Point (pI)

30.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 221
AgeI ACCGGT 1 cut(s) 347
AgsI TTSAA 5 cut(s) 71, 121, 143, 265, 272
AluBI AGCT 4 cut(s) 148, 233, 256, 268
AluI AGCT 4 cut(s) 148, 233, 256, 268
AlwI GGATC 1 cut(s) 221
AseI ATTAAT 1 cut(s) 207
AsiGI ACCGGT 1 cut(s) 347
Asp700I GAANNNNTTC 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 337
BfaI CTAG 1 cut(s) 353
BpuEI CTTGAG 1 cut(s) 307
BsaWI WCCGGW 1 cut(s) 347
Bse118I RCCGGY 1 cut(s) 347
Bse3DI GCAATG 1 cut(s) 295
BseMI GCAATG 1 cut(s) 295
BseMII CTCAG 2 cut(s) 123, 248
BseYI CCCAGC 1 cut(s) 187
BshTI ACCGGT 1 cut(s) 347
BsiSI CCGG 1 cut(s) 348
Bsp143I GATC 2 cut(s) 226, 355
BspCNI CTCAG 2 cut(s) 124, 249
BspHI TCATGA 1 cut(s) 151
BspPI GGATC 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 295
BsrFI RCCGGY 1 cut(s) 347
BssAI RCCGGY 1 cut(s) 347
BssMI GATC 2 cut(s) 226, 355
BstDEI CTNAG 3 cut(s) 132, 257, 369
BstKTI GATC 2 cut(s) 229, 358
BstMBI GATC 2 cut(s) 226, 355
BstMWI GCNNNNNNNGC 1 cut(s) 145
CciI TCATGA 1 cut(s) 151
Cfr10I RCCGGY 1 cut(s) 347
CspAI ACCGGT 1 cut(s) 347
CviAII CATG 3 cut(s) 113, 152, 193
CviJI RGCY 5 cut(s) 148, 191, 233, 256, 268
CviKI_1 RGCY 5 cut(s) 148, 191, 233, 256, 268
DdeI CTNAG 3 cut(s) 132, 257, 369
DpnI GATC 2 cut(s) 228, 357
DpnII GATC 2 cut(s) 226, 355
FaeI CATG 3 cut(s) 116, 155, 196
FaiI YATR 8 cut(s) 23, 114, 153, 184, 194, 283, 285, 308
FatI CATG 3 cut(s) 112, 151, 192
FauNDI CATATG 1 cut(s) 283
FspBI CTAG 1 cut(s) 353
GsaI CCCAGC 1 cut(s) 191
HapII CCGG 1 cut(s) 348
Hin1II CATG 3 cut(s) 116, 155, 196
HindIII AAGCTT 2 cut(s) 146, 266
HinfI GANTC 2 cut(s) 74, 216
HpaII CCGG 1 cut(s) 348
HphI GGTGA 1 cut(s) 337
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 5 cut(s) 152, 224, 335, 353, 359
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 3 cut(s) 132, 257, 369
Hsp92II CATG 3 cut(s) 116, 155, 196
Kzo9I GATC 2 cut(s) 226, 355
LmnI GCTCC 1 cut(s) 162
LpnPI CCDG 6 cut(s) 201, 214, 243, 299, 348, 361
MaeI CTAG 1 cut(s) 353
MalI GATC 2 cut(s) 228, 357
MboI GATC 2 cut(s) 226, 355
MboII GAAGA 3 cut(s) 83, 253, 321
MluCI AATT 1 cut(s) 246
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 2 cut(s) 76, 91
MroXI GAANNNNTTC 1 cut(s) 147
MseI TTAA 2 cut(s) 105, 207
MspI CCGG 1 cut(s) 348
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeI CATATG 1 cut(s) 283
NdeII GATC 2 cut(s) 226, 355
NlaIII CATG 3 cut(s) 116, 155, 196
PagI TCATGA 1 cut(s) 151
PdmI GAANNNNTTC 1 cut(s) 147
PfeI GAWTC 2 cut(s) 74, 216
PinAI ACCGGT 1 cut(s) 347
PshBI ATTAAT 1 cut(s) 207
PspFI CCCAGC 1 cut(s) 187
SaqAI TTAA 2 cut(s) 105, 207
Sau3AI GATC 2 cut(s) 226, 355
SetI ASST 7 cut(s) 87, 111, 150, 235, 258, 270, 370
SmlI CTYRAG 1 cut(s) 322
SmoI CTYRAG 1 cut(s) 322
Sse9I AATT 1 cut(s) 246
SspMI CTAG 1 cut(s) 353
TaqI TCGA 1 cut(s) 96
TasI AATT 1 cut(s) 246
TfiI GAWTC 2 cut(s) 74, 216
Tru1I TTAA 2 cut(s) 105, 207
Tru9I TTAA 2 cut(s) 105, 207
TspDTI ATGAA 5 cut(s) 66, 101, 140, 254, 285
VspI ATTAAT 1 cut(s) 207
XbaI TCTAGA 1 cut(s) 352
XmnI GAANNNNTTC 1 cut(s) 147
XspI CTAG 1 cut(s) 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.