Rh6DG217900

Branched-chain-amino-acid aminotransferase-like protein 3

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
38825022 .. 38829745
4724 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG217900.1

Sequence Viewer

Length: 246 bp
ATGTATTCATTGGAGGTTGGAAATGTCGAGGATTTTAAGGTTCATGTGTTCAAATCATCATCTGAGTTGCTTGAAAAGCTTCATGAGAAGTGGAGCAAAGTAGGAAAGAAACCATACCCAGCCATGTATTCCAGCATTTATGGTGGAATCATTCTTGATCCAGCTTTGATGGTGATTCCAATAGACGATCACATGGTTCATCGAGGCCATGGTGTGTTTGACACAGCCATTCTCTTAAATGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.1

Weight (kDa)

6.16

Isoelectric Point (pI)

20.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 152
AgsI TTSAA 2 cut(s) 52, 74
AluBI AGCT 2 cut(s) 79, 164
AluI AGCT 2 cut(s) 79, 164
AlwI GGATC 1 cut(s) 152
AoxI GGCC 1 cut(s) 205
Asp700I GAANNNNTTC 1 cut(s) 78
AsuHPI GGTGA 1 cut(s) 184
BccI CCATC 1 cut(s) 163
BsaJI CCNNGG 1 cut(s) 208
BseDI CCNNGG 1 cut(s) 208
BseMII CTCAG 1 cut(s) 54
BseYI CCCAGC 1 cut(s) 118
BshFI GGCC 1 cut(s) 207
BsnI GGCC 1 cut(s) 207
Bsp143I GATC 2 cut(s) 157, 187
Bsp19I CCATGG 1 cut(s) 208
BspANI GGCC 1 cut(s) 207
BspCNI CTCAG 1 cut(s) 55
BspHI TCATGA 1 cut(s) 82
BspPI GGATC 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 208
BssMI GATC 2 cut(s) 157, 187
BssT1I CCWWGG 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 63
BstDSI CCRYGG 1 cut(s) 208
BstKTI GATC 2 cut(s) 160, 190
BstMBI GATC 2 cut(s) 157, 187
BstMWI GCNNNNNNNGC 1 cut(s) 76
BsuRI GGCC 1 cut(s) 207
BtgI CCRYGG 1 cut(s) 208
CciI TCATGA 1 cut(s) 82
CviAII CATG 5 cut(s) 44, 83, 124, 193, 209
CviJI RGCY 5 cut(s) 79, 122, 164, 207, 227
CviKI_1 RGCY 5 cut(s) 79, 122, 164, 207, 227
DdeI CTNAG 1 cut(s) 63
DpnI GATC 2 cut(s) 159, 189
DpnII GATC 2 cut(s) 157, 187
Eco130I CCWWGG 1 cut(s) 208
EcoT14I CCWWGG 1 cut(s) 208
ErhI CCWWGG 1 cut(s) 208
FaeI CATG 5 cut(s) 47, 86, 127, 196, 212
FaiI YATR 7 cut(s) 45, 84, 115, 125, 141, 194, 210
FatI CATG 5 cut(s) 43, 82, 123, 192, 208
GsaI CCCAGC 1 cut(s) 122
HaeIII GGCC 1 cut(s) 207
Hin1II CATG 5 cut(s) 47, 86, 127, 196, 212
HindIII AAGCTT 1 cut(s) 77
HinfI GANTC 2 cut(s) 147, 175
HphI GGTGA 1 cut(s) 184
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 2 cut(s) 83, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 63
Hsp92II CATG 5 cut(s) 47, 86, 127, 196, 212
Kzo9I GATC 2 cut(s) 157, 187
LmnI GCTCC 1 cut(s) 93
LpnPI CCDG 3 cut(s) 132, 145, 174
MalI GATC 2 cut(s) 159, 189
MboI GATC 2 cut(s) 157, 187
MnlI CCTC 3 cut(s) 7, 22, 197
MroXI GAANNNNTTC 1 cut(s) 78
MseI TTAA 2 cut(s) 36, 236
MwoI GCNNNNNNNGC 1 cut(s) 76
NcoI CCATGG 1 cut(s) 208
NdeII GATC 2 cut(s) 157, 187
NlaIII CATG 5 cut(s) 47, 86, 127, 196, 212
PagI TCATGA 1 cut(s) 82
PdmI GAANNNNTTC 1 cut(s) 78
PfeI GAWTC 2 cut(s) 147, 175
PspFI CCCAGC 1 cut(s) 118
SaqAI TTAA 2 cut(s) 36, 236
Sau3AI GATC 2 cut(s) 157, 187
SetI ASST 4 cut(s) 18, 42, 81, 166
StyI CCWWGG 1 cut(s) 208
TaqI TCGA 2 cut(s) 27, 202
TfiI GAWTC 2 cut(s) 147, 175
Tru1I TTAA 2 cut(s) 36, 236
Tru9I TTAA 2 cut(s) 36, 236
TspDTI ATGAA 3 cut(s) 32, 71, 188
XmnI GAANNNNTTC 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.