RchiOBHm_Chr4g0387681

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
2909009 .. 2910121
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36097

Sequence Viewer

Length: 207 bp
ATGATTCATTGGATTGGAGAAGCTACGTACAAGAGCTTGACTTGTCTTCCAACCTGTTGGACCAAGGGCTTAGGTGGAGTTGATGAGAAAGATGTGAGGAAGGCTCTTAAGGGCAGATCAGAAGCTGAGGTGAAAAGGGTCATTGACATTCTCATGGGTGAGTTAATAAGCTATTTAATCCTTTTCATTGAACTAGCTAGTGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.61

Weight (kDa)

6.55

Isoelectric Point (pI)

37.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 29
AflII CTTAAG 1 cut(s) 107
AgsI TTSAA 1 cut(s) 191
AluBI AGCT 5 cut(s) 23, 36, 125, 171, 197
AluI AGCT 5 cut(s) 23, 36, 125, 171, 197
AlwNI CAGNNNCTG 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 60
AsuHPI GGTGA 2 cut(s) 142, 170
AvaII GGWCC 1 cut(s) 60
BbsI GAAGAC 1 cut(s) 38
BbvCI CCTCAGC 1 cut(s) 126
BfaI CTAG 2 cut(s) 194, 198
BfrI CTTAAG 1 cut(s) 107
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 60
BpiI GAAGAC 1 cut(s) 38
BplI GAGNNNNNCTC 2 cut(s) 88, 120
Bpu10I CCTNAGC 2 cut(s) 70, 126
BsaAI YACGTR 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 117
Bsp143I GATC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 118
BspTI CTTAAG 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 63
BssMI GATC 1 cut(s) 116
BssT1I CCWWGG 1 cut(s) 63
BstAFI CTTAAG 1 cut(s) 107
BstBAI YACGTR 1 cut(s) 27
BstDEI CTNAG 2 cut(s) 70, 126
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstSNI TACGTA 1 cut(s) 27
BstV2I GAAGAC 1 cut(s) 38
BstXI CCANNNNNNTGG 1 cut(s) 57
CaiI CAGNNNCTG 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 60
Csp6I GTAC 1 cut(s) 28
CviAII CATG 1 cut(s) 154
CviJI RGCY 7 cut(s) 23, 36, 69, 104, 125, 171, 197
CviKI_1 RGCY 7 cut(s) 23, 36, 69, 104, 125, 171, 197
CviQI GTAC 1 cut(s) 28
DdeI CTNAG 2 cut(s) 70, 126
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
Eco105I TACGTA 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 63
Eco47I GGWCC 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 63
ErhI CCWWGG 1 cut(s) 63
FaeI CATG 1 cut(s) 157
FaiI YATR 1 cut(s) 155
FatI CATG 1 cut(s) 153
FspBI CTAG 2 cut(s) 194, 198
Hin1II CATG 1 cut(s) 157
HinfI GANTC 1 cut(s) 4
HphI GGTGA 2 cut(s) 142, 170
Hpy188I TCNGA 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 26
HpyF3I CTNAG 2 cut(s) 70, 126
HpySE526I ACGT 1 cut(s) 26
Hsp92II CATG 1 cut(s) 157
Kzo9I GATC 1 cut(s) 116
LpnPI CCDG 1 cut(s) 67
MaeI CTAG 2 cut(s) 194, 198
MaeII ACGT 1 cut(s) 26
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 1 cut(s) 38
MmeI TCCRAC 2 cut(s) 38, 74
MnlI CCTC 2 cut(s) 90, 121
MseI TTAA 3 cut(s) 108, 164, 176
MslI CAYNNNNRTG 1 cut(s) 152
MspCI CTTAAG 1 cut(s) 107
NdeII GATC 1 cut(s) 116
NlaIII CATG 1 cut(s) 157
PfeI GAWTC 1 cut(s) 4
Ppu21I YACGTR 1 cut(s) 27
PspPI GGNCC 1 cut(s) 60
PstNI CAGNNNCTG 1 cut(s) 125
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
RseI CAYNNNNRTG 1 cut(s) 152
SaqAI TTAA 3 cut(s) 108, 164, 176
Sau3AI GATC 1 cut(s) 116
Sau96I GGNCC 1 cut(s) 60
SetI ASST 9 cut(s) 25, 29, 38, 56, 76, 127, 132, 173, 199
SgeI CNNG 6 cut(s) 43, 49, 54, 66, 76, 166
SinI GGWCC 1 cut(s) 60
SmiMI CAYNNNNRTG 1 cut(s) 152
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
SnaBI TACGTA 1 cut(s) 27
SspMI CTAG 2 cut(s) 194, 198
StyI CCWWGG 1 cut(s) 63
TaiI ACGT 1 cut(s) 29
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 3 cut(s) 108, 164, 176
Tru9I TTAA 3 cut(s) 108, 164, 176
TspDTI ATGAA 1 cut(s) 175
Vha464I CTTAAG 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 60
XspI CTAG 2 cut(s) 194, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.