Rh6BG278600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
50070491 .. 50074247
3757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG278600.1

Sequence Viewer

Length: 342 bp
ATGTCACCCCTGAAAAAGTTGCCAAATTTTAAACTATATAATTATGGATGGGAACTTGGTTTGCCCTGCAAAGATGGGAAGATCTGTAGCTGTAGGACGTTTGTGTTTTTATCAAAACACGGAGAGGAAGCATGGACACCCACCCAACTAAACAAAGGTGCCTCCAAGTTTGGTATAACATCACAGGTTTGTCTTCTCTATTCTTCCCAGCAAGTCTTAGACTTTAATTTATGTAATTGTTTATGTCTGCCATGTATACCTGGAAGCAACTTGAATAAGGTGTATTTACTTGATGTCCCTTATTGCATAACCTTAGTAATACGAAGTCATACGGTTTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.67

Weight (kDa)

8.76

Isoelectric Point (pI)

33.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 158
AccI GTMKAC 1 cut(s) 256
AcsI RAATTY 1 cut(s) 25
AgsI TTSAA 1 cut(s) 274
AjnI CCWGG 1 cut(s) 259
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
ApoI RAATTY 1 cut(s) 25
BanI GGYRCC 1 cut(s) 158
BbsI GAAGAC 1 cut(s) 185
BccI CCATC 2 cut(s) 42, 68
BciT130I CCWGG 1 cut(s) 261
BfmI CTRYAG 2 cut(s) 85, 91
BglII AGATCT 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 261
BmiI GGNNCC 1 cut(s) 160
BmrFI CCNGG 1 cut(s) 261
BpiI GAAGAC 1 cut(s) 185
BseBI CCWGG 1 cut(s) 261
BseGI GGATG 1 cut(s) 53
BseYI CCCAGC 1 cut(s) 207
BshNI GGYRCC 1 cut(s) 158
BslFI GGGAC 1 cut(s) 281
BsmFI GGGAC 1 cut(s) 281
Bsp143I GATC 1 cut(s) 81
BspLI GGNNCC 1 cut(s) 160
BspT107I GGYRCC 1 cut(s) 158
BssMI GATC 1 cut(s) 81
BssNAI GTATAC 1 cut(s) 257
Bst1107I GTATAC 1 cut(s) 257
Bst2UI CCWGG 1 cut(s) 261
Bst4CI ACNGT 1 cut(s) 334
BstDEI CTNAG 3 cut(s) 217, 313, 339
BstF5I GGATG 1 cut(s) 53
BstKTI GATC 1 cut(s) 84
BstMBI GATC 1 cut(s) 81
BstNI CCWGG 1 cut(s) 261
BstSCI CCNGG 1 cut(s) 259
BstSFI CTRYAG 2 cut(s) 85, 91
BstV2I GAAGAC 1 cut(s) 185
BstX2I RGATCY 1 cut(s) 81
BstYI RGATCY 1 cut(s) 81
BstZ17I GTATAC 1 cut(s) 257
BtsCI GGATG 1 cut(s) 53
CviAII CATG 2 cut(s) 132, 252
CviJI RGCY 1 cut(s) 90
CviKI_1 RGCY 1 cut(s) 90
DdeI CTNAG 3 cut(s) 217, 313, 339
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
DraI TTTAAA 1 cut(s) 31
EcoRII CCWGG 1 cut(s) 259
FaeI CATG 2 cut(s) 135, 255
FaqI GGGAC 1 cut(s) 281
FatI CATG 2 cut(s) 131, 251
FblI GTMKAC 1 cut(s) 256
FokI GGATG 1 cut(s) 60
GsaI CCCAGC 1 cut(s) 211
Hin1II CATG 2 cut(s) 135, 255
Hpy166II GTNNAC 1 cut(s) 257
Hpy8I GTNNAC 1 cut(s) 257
HpyCH4III ACNGT 1 cut(s) 334
HpyCH4IV ACGT 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 69, 306
HpyF3I CTNAG 3 cut(s) 217, 313, 339
HpySE526I ACGT 1 cut(s) 98
Hsp92II CATG 2 cut(s) 135, 255
Kzo9I GATC 1 cut(s) 81
LpnPI CCDG 6 cut(s) 23, 79, 170, 221, 246, 273
MaeII ACGT 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 3
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MboII GAAGA 3 cut(s) 91, 185, 195
MflI RGATCY 1 cut(s) 81
MluCI AATT 4 cut(s) 25, 40, 226, 235
MnlI CCTC 2 cut(s) 118, 172
MseI TTAA 2 cut(s) 30, 225
MspR9I CCNGG 1 cut(s) 261
MvaI CCWGG 1 cut(s) 261
NdeII GATC 1 cut(s) 81
NlaIII CATG 2 cut(s) 135, 255
NlaIV GGNNCC 1 cut(s) 160
NmuCI GTSAC 1 cut(s) 3
Psp6I CCWGG 1 cut(s) 259
PspFI CCCAGC 1 cut(s) 207
PspGI CCWGG 1 cut(s) 259
PspN4I GGNNCC 1 cut(s) 160
PsuI RGATCY 1 cut(s) 81
SaqAI TTAA 2 cut(s) 30, 225
Sau3AI GATC 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 261
SetI ASST 7 cut(s) 92, 101, 160, 189, 262, 282, 314
SfcI CTRYAG 2 cut(s) 85, 91
Sse9I AATT 4 cut(s) 25, 40, 226, 235
StyD4I CCNGG 1 cut(s) 259
TaaI ACNGT 1 cut(s) 334
TaiI ACGT 1 cut(s) 101
TasI AATT 4 cut(s) 25, 40, 226, 235
Tru1I TTAA 2 cut(s) 30, 225
Tru9I TTAA 2 cut(s) 30, 225
TseFI GTSAC 1 cut(s) 3
Tsp45I GTSAC 1 cut(s) 3
TspGWI ACGGA 1 cut(s) 135
XapI RAATTY 1 cut(s) 25
XmiI GTMKAC 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.