RchiOBHm_Chr4g0406751

HB1, ASXL, restriction endonuclease HTH domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
28513782 .. 28514462
681 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37803

Sequence Viewer

Length: 177 bp
ATGAAAAAGGACGTACGTGTTACTAGCAATTTTTCTTTTCCTGATAGCGTTGTTGTGCTTCAATGGATACCACTTACAACAGTTGCTGTGGCTCTTAGGCTCATGGAGTTTGATATATGTGGCCATCGTAAACATGCTACAGAAGAAGCTGGAGACTCAGAAGAACAAGGAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.5

Weight (kDa)

5.11

Isoelectric Point (pI)

44.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 121
AfaI GTAC 1 cut(s) 15
AflIII ACRYGT 1 cut(s) 16
AgsI TTSAA 1 cut(s) 62
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
Alw26I GTCTC 1 cut(s) 147
AlwNI CAGNNNCTG 1 cut(s) 86
AoxI GGCC 1 cut(s) 121
BalI TGGCCA 1 cut(s) 123
BccI CCATC 1 cut(s) 132
BciVI GTATCC 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 147
BfaI CTAG 1 cut(s) 24
BfmI CTRYAG 1 cut(s) 138
BfuI GTATCC 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 171
BsaAI YACGTR 1 cut(s) 17
BseMII CTCAG 1 cut(s) 171
BshFI GGCC 1 cut(s) 123
BsiWI CGTACG 1 cut(s) 13
BsmAI GTCTC 1 cut(s) 147
BsnI GGCC 1 cut(s) 123
BspANI GGCC 1 cut(s) 123
BspCNI CTCAG 1 cut(s) 170
Bst4CI ACNGT 1 cut(s) 82
BstBAI YACGTR 1 cut(s) 17
BstDEI CTNAG 2 cut(s) 95, 157
BstMAI GTCTC 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 137
BstSFI CTRYAG 1 cut(s) 138
BsuI GTATCC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 123
CaiI CAGNNNCTG 1 cut(s) 86
Csp6I GTAC 1 cut(s) 14
CviAII CATG 2 cut(s) 103, 134
CviJI RGCY 4 cut(s) 92, 100, 123, 149
CviKI_1 RGCY 4 cut(s) 92, 100, 123, 149
CviQI GTAC 1 cut(s) 14
DdeI CTNAG 2 cut(s) 95, 157
EaeI YGGCCR 1 cut(s) 121
FaeI CATG 2 cut(s) 106, 137
FaiI YATR 4 cut(s) 104, 116, 118, 135
FatI CATG 2 cut(s) 102, 133
FspBI CTAG 1 cut(s) 24
GsuI CTGGAG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 123
Hin1II CATG 2 cut(s) 106, 137
HinfI GANTC 2 cut(s) 155, 171
Hpy166II GTNNAC 1 cut(s) 131
Hpy188I TCNGA 2 cut(s) 160, 176
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4IV ACGT 2 cut(s) 12, 16
HpyF3I CTNAG 2 cut(s) 95, 157
HpySE526I ACGT 2 cut(s) 12, 16
Hsp92II CATG 2 cut(s) 106, 137
LpnPI CCDG 2 cut(s) 54, 135
MaeI CTAG 1 cut(s) 24
MaeII ACGT 2 cut(s) 12, 16
MaeIII GTNAC 1 cut(s) 19
MboII GAAGA 2 cut(s) 155, 173
MlsI TGGCCA 1 cut(s) 123
MluCI AATT 1 cut(s) 28
MluNI TGGCCA 1 cut(s) 123
MlyI GAGTC 1 cut(s) 149
Mox20I TGGCCA 1 cut(s) 123
MscI TGGCCA 1 cut(s) 123
Msp20I TGGCCA 1 cut(s) 123
NlaIII CATG 2 cut(s) 106, 137
NspI RCATGY 1 cut(s) 137
PfeI GAWTC 1 cut(s) 171
Pfl23II CGTACG 1 cut(s) 13
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
Ppu21I YACGTR 1 cut(s) 17
PspLI CGTACG 1 cut(s) 13
PstNI CAGNNNCTG 1 cut(s) 86
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
SchI GAGTC 1 cut(s) 149
SetI ASST 3 cut(s) 15, 19, 151
SfcI CTRYAG 1 cut(s) 138
SgeI CNNG 6 cut(s) 29, 36, 53, 115, 146, 162
Sse9I AATT 1 cut(s) 28
SspMI CTAG 1 cut(s) 24
TaaI ACNGT 1 cut(s) 82
TaiI ACGT 2 cut(s) 15, 19
TasI AATT 1 cut(s) 28
TfiI GAWTC 1 cut(s) 171
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 137
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.