Rh3CG286800

HB1, ASXL, restriction endonuclease HTH domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
28977589 .. 28979925
2337 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG286800.1

Sequence Viewer

Length: 195 bp
ATGAAAAAGGATGTTCGTGTTACTAGCAATTTTTCTTTTCCTGATAGCGTTGTTGTGCTTCCATGGATACCACTTACAACAGTTGTTGTGGCTCTTAGGCTCATGGAGTTTGATATATGTGGCCATCGTAAACATGCTAGAGAAGAAGCTGGAGACTCTGAAGAACAAGGAATCTGGGAATTTTATATCGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.41

Weight (kDa)

4.97

Isoelectric Point (pI)

41.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 121
AcsI RAATTY 1 cut(s) 179
AcuI CTGAAG 1 cut(s) 180
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
Alw26I GTCTC 1 cut(s) 147
AoxI GGCC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 179
BalI TGGCCA 1 cut(s) 123
BccI CCATC 1 cut(s) 132
BciVI GTATCC 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 147
BfaI CTAG 2 cut(s) 24, 138
BfuI GTATCC 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 62
BseGI GGATG 1 cut(s) 16
BshFI GGCC 1 cut(s) 123
BsmAI GTCTC 1 cut(s) 147
BsnI GGCC 1 cut(s) 123
Bsp19I CCATGG 1 cut(s) 62
BspANI GGCC 1 cut(s) 123
BssECI CCNNGG 1 cut(s) 62
BssT1I CCWWGG 1 cut(s) 62
Bst4CI ACNGT 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 95
BstDSI CCRYGG 1 cut(s) 62
BstF5I GGATG 1 cut(s) 16
BstMAI GTCTC 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 137
BsuI GTATCC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 123
BtgI CCRYGG 1 cut(s) 62
BtsCI GGATG 1 cut(s) 16
CviAII CATG 3 cut(s) 63, 103, 134
CviJI RGCY 4 cut(s) 92, 100, 123, 149
CviKI_1 RGCY 4 cut(s) 92, 100, 123, 149
DdeI CTNAG 1 cut(s) 95
EaeI YGGCCR 1 cut(s) 121
Eco130I CCWWGG 1 cut(s) 62
Eco57I CTGAAG 1 cut(s) 180
EcoT14I CCWWGG 1 cut(s) 62
ErhI CCWWGG 1 cut(s) 62
FaeI CATG 3 cut(s) 66, 106, 137
FaiI YATR 6 cut(s) 64, 104, 116, 118, 135, 186
FatI CATG 3 cut(s) 62, 102, 133
FokI GGATG 1 cut(s) 23
FspBI CTAG 2 cut(s) 24, 138
GsuI CTGGAG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 123
Hin1II CATG 3 cut(s) 66, 106, 137
HinfI GANTC 2 cut(s) 155, 171
Hpy166II GTNNAC 1 cut(s) 131
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 95
Hsp92II CATG 3 cut(s) 66, 106, 137
LpnPI CCDG 3 cut(s) 54, 135, 160
MaeI CTAG 2 cut(s) 24, 138
MaeIII GTNAC 1 cut(s) 19
MboII GAAGA 2 cut(s) 155, 173
MlsI TGGCCA 1 cut(s) 123
MluCI AATT 2 cut(s) 28, 179
MluNI TGGCCA 1 cut(s) 123
MlyI GAGTC 1 cut(s) 149
Mox20I TGGCCA 1 cut(s) 123
MscI TGGCCA 1 cut(s) 123
Msp20I TGGCCA 1 cut(s) 123
NcoI CCATGG 1 cut(s) 62
NlaIII CATG 3 cut(s) 66, 106, 137
NspI RCATGY 1 cut(s) 137
PfeI GAWTC 1 cut(s) 171
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
SchI GAGTC 1 cut(s) 149
SetI ASST 1 cut(s) 151
Sse9I AATT 2 cut(s) 28, 179
SspMI CTAG 2 cut(s) 24, 138
StyI CCWWGG 1 cut(s) 62
TaaI ACNGT 1 cut(s) 82
TaqI TCGA 1 cut(s) 189
TasI AATT 2 cut(s) 28, 179
TfiI GAWTC 1 cut(s) 171
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 179
XceI RCATGY 1 cut(s) 137
XspI CTAG 2 cut(s) 24, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.