RchiOBHm_Chr4g0408851

Casein kinase II subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
31711366 .. 31713857
2492 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37992

Sequence Viewer

Length: 183 bp
ATGTCCAAAGCTGGTGGCTACGCCGACATCAAGATCCTACGCCCCAAGGAGTACCCGGACTACGAGTCCTTCACCGTCAAATGGGGTGATCAATATGATTATGAGGTTGTGAGGAAAGTTGGGAGAGGGAAATACAGCGAGGTCTTTGAAGGTACTAATCTCAATACCAATAGCAATACATAA

Protein Analysis

60

Amino Acids

6.92

Weight (kDa)

6.16

Isoelectric Point (pI)

17.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 28
AfaI GTAC 2 cut(s) 53, 154
AfiI CCNNNNNNNGG 1 cut(s) 81
AgsI TTSAA 1 cut(s) 149
AhdI GACNNNNNGTC 1 cut(s) 64
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AlwI GGATC 1 cut(s) 28
AsuC2I CCSGG 1 cut(s) 56
AsuHPI GGTGA 2 cut(s) 64, 98
BclI TGATCA 1 cut(s) 88
BcnI CCSGG 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 56
BmeRI GACNNNNNGTC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 56
BpuMI CCSGG 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 81
BsiSI CCGG 1 cut(s) 56
BslI CCNNNNNNNGG 1 cut(s) 81
Bsp143I GATC 2 cut(s) 33, 88
BspPI GGATC 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 2 cut(s) 33, 88
BssT1I CCWWGG 1 cut(s) 45
Bst4CI ACNGT 1 cut(s) 76
BstKTI GATC 2 cut(s) 36, 91
BstMBI GATC 2 cut(s) 33, 88
BstSCI CCNGG 1 cut(s) 54
BstX2I RGATCY 1 cut(s) 33
BstYI RGATCY 1 cut(s) 33
Csp6I GTAC 2 cut(s) 52, 153
CspCI CAANNNNNGTGG 1 cut(s) 30
CviJI RGCY 2 cut(s) 11, 18
CviKI_1 RGCY 2 cut(s) 11, 18
CviQI GTAC 2 cut(s) 52, 153
DpnI GATC 2 cut(s) 35, 90
DpnII GATC 2 cut(s) 33, 88
DriI GACNNNNNGTC 1 cut(s) 64
Eam1105I GACNNNNNGTC 1 cut(s) 64
Eco130I CCWWGG 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaiI YATR 3 cut(s) 96, 102, 181
FbaI TGATCA 1 cut(s) 88
HapII CCGG 1 cut(s) 56
HinfI GANTC 1 cut(s) 65
HpaII CCGG 1 cut(s) 56
HphI GGTGA 2 cut(s) 64, 98
Hpy188III TCNNGA 1 cut(s) 31
HpyAV CCTTC 2 cut(s) 79, 143
HpyCH4III ACNGT 1 cut(s) 76
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 2 cut(s) 33, 88
LpnPI CCDG 1 cut(s) 69
MalI GATC 2 cut(s) 35, 90
MboI GATC 2 cut(s) 33, 88
MflI RGATCY 1 cut(s) 33
MlyI GAGTC 1 cut(s) 74
MnlI CCTC 4 cut(s) 97, 105, 119, 133
MspI CCGG 1 cut(s) 56
MspR9I CCNGG 1 cut(s) 56
NciI CCSGG 1 cut(s) 56
NdeII GATC 2 cut(s) 33, 88
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
PsuI RGATCY 1 cut(s) 33
RsaI GTAC 2 cut(s) 53, 154
RsaNI GTAC 2 cut(s) 52, 153
Sau3AI GATC 2 cut(s) 33, 88
SchI GAGTC 1 cut(s) 74
ScrFI CCNGG 1 cut(s) 56
SetI ASST 4 cut(s) 13, 108, 144, 154
SgeI CNNG 7 cut(s) 24, 43, 58, 67, 68, 76, 151
StyD4I CCNGG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.