Rh5CG397800

Casein kinase II subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
52847911 .. 52850605
2695 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG397800.1

Sequence Viewer

Length: 183 bp
ATGTCCAAAGCTGGTGGCTACGCCGACATCAAGATCCTACGCCCCAAGGAGTACCCGGACTACGAGTCCTTCACCGTCAAATGGGGTGATCAATATGATTATGAGGTTGTGAGGAAAGTTGGGAGAGGGAAATACAGCGAGATTTGGGAATCCTCTAGTTATGAGAAATTTCGAGGGTTCTGA

Protein Analysis

60

Amino Acids

7.14

Weight (kDa)

7.91

Isoelectric Point (pI)

36.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 28
AcsI RAATTY 1 cut(s) 167
AfaI GTAC 1 cut(s) 53
AfiI CCNNNNNNNGG 1 cut(s) 81
AhdI GACNNNNNGTC 1 cut(s) 64
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AlwI GGATC 1 cut(s) 28
ApoI RAATTY 1 cut(s) 167
AsuC2I CCSGG 1 cut(s) 56
AsuHPI GGTGA 2 cut(s) 64, 98
BclI TGATCA 1 cut(s) 88
BcnI CCSGG 1 cut(s) 56
BfaI CTAG 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 56
BmeRI GACNNNNNGTC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 56
BpuMI CCSGG 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 81
BsiSI CCGG 1 cut(s) 56
BslI CCNNNNNNNGG 1 cut(s) 81
Bsp143I GATC 2 cut(s) 33, 88
BspPI GGATC 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 2 cut(s) 33, 88
BssT1I CCWWGG 1 cut(s) 45
Bst4CI ACNGT 1 cut(s) 76
BstKTI GATC 2 cut(s) 36, 91
BstMBI GATC 2 cut(s) 33, 88
BstSCI CCNGG 1 cut(s) 54
BstX2I RGATCY 1 cut(s) 33
BstYI RGATCY 1 cut(s) 33
Csp6I GTAC 1 cut(s) 52
CspCI CAANNNNNGTGG 1 cut(s) 30
CviJI RGCY 2 cut(s) 11, 18
CviKI_1 RGCY 2 cut(s) 11, 18
CviQI GTAC 1 cut(s) 52
DpnI GATC 2 cut(s) 35, 90
DpnII GATC 2 cut(s) 33, 88
DriI GACNNNNNGTC 1 cut(s) 64
Eam1105I GACNNNNNGTC 1 cut(s) 64
Eco130I CCWWGG 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaiI YATR 3 cut(s) 96, 102, 162
FbaI TGATCA 1 cut(s) 88
FspBI CTAG 1 cut(s) 156
HapII CCGG 1 cut(s) 56
HinfI GANTC 2 cut(s) 65, 149
HpaII CCGG 1 cut(s) 56
HphI GGTGA 2 cut(s) 64, 98
Hpy188I TCNGA 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 79
HpyCH4III ACNGT 1 cut(s) 76
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 2 cut(s) 33, 88
LpnPI CCDG 1 cut(s) 69
MaeI CTAG 1 cut(s) 156
MalI GATC 2 cut(s) 35, 90
MboI GATC 2 cut(s) 33, 88
MflI RGATCY 1 cut(s) 33
MluCI AATT 1 cut(s) 167
MlyI GAGTC 1 cut(s) 74
MnlI CCTC 5 cut(s) 97, 105, 119, 163, 167
MspI CCGG 1 cut(s) 56
MspR9I CCNGG 1 cut(s) 56
NciI CCSGG 1 cut(s) 56
NdeII GATC 2 cut(s) 33, 88
PfeI GAWTC 1 cut(s) 149
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
PsuI RGATCY 1 cut(s) 33
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
Sau3AI GATC 2 cut(s) 33, 88
SchI GAGTC 1 cut(s) 74
ScrFI CCNGG 1 cut(s) 56
SetI ASST 2 cut(s) 13, 108
SgeI CNNG 8 cut(s) 24, 43, 58, 67, 68, 76, 151, 168
Sse9I AATT 1 cut(s) 167
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 76
TaqI TCGA 1 cut(s) 172
TasI AATT 1 cut(s) 167
TfiI GAWTC 1 cut(s) 149
XapI RAATTY 1 cut(s) 167
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.