RchiOBHm_Chr4g0437151

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
60325935 .. 60326084
150 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40541

Sequence Viewer

Length: 150 bp
ATGTACCCATTCAGATCTTTCTCATCTTTTCAAGTTGTCATGGAGGTCTGGACTTATGGAGCAAGGCAGCAGGCCGATCAACTAGAGCCTAAAGGCCTAGAGCAGTGCAGCTTCAATTATTTCTTAGTTGGAAAGTTTGACTATTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.85

Weight (kDa)

4.94

Isoelectric Point (pI)

35.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 2 cut(s) 32, 115
AluBI AGCT 1 cut(s) 111
AluI AGCT 1 cut(s) 111
AoxI GGCC 2 cut(s) 72, 94
ApeKI GCWGC 2 cut(s) 67, 108
BbvI GCAGC 2 cut(s) 79, 120
BfaI CTAG 2 cut(s) 83, 98
BglII AGATCT 1 cut(s) 14
BisI GCNGC 2 cut(s) 68, 109
BlsI GCNGC 2 cut(s) 69, 110
BseXI GCAGC 2 cut(s) 79, 120
BsgI GTGCAG 1 cut(s) 127
BshFI GGCC 2 cut(s) 74, 96
BsnI GGCC 2 cut(s) 74, 96
Bsp143I GATC 2 cut(s) 14, 76
BspANI GGCC 2 cut(s) 74, 96
BssMI GATC 2 cut(s) 14, 76
BstC8I GCNNGC 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 124
BstKTI GATC 2 cut(s) 17, 79
BstMBI GATC 2 cut(s) 14, 76
BstV1I GCAGC 2 cut(s) 79, 120
BstX2I RGATCY 1 cut(s) 14
BstYI RGATCY 1 cut(s) 14
BsuRI GGCC 2 cut(s) 74, 96
BtsI GCAGTG 1 cut(s) 110
BtsIMutI CAGTG 1 cut(s) 110
Cac8I GCNNGC 1 cut(s) 72
Csp6I GTAC 1 cut(s) 4
CviAII CATG 1 cut(s) 40
CviJI RGCY 4 cut(s) 74, 88, 96, 111
CviKI_1 RGCY 4 cut(s) 74, 88, 96, 111
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 124
DpnI GATC 2 cut(s) 16, 78
DpnII GATC 2 cut(s) 14, 76
Eco147I AGGCCT 1 cut(s) 96
FaeI CATG 1 cut(s) 43
FaiI YATR 2 cut(s) 41, 57
FatI CATG 1 cut(s) 39
Fnu4HI GCNGC 2 cut(s) 68, 109
Fsp4HI GCNGC 2 cut(s) 68, 109
FspBI CTAG 2 cut(s) 83, 98
GluI GCNGC 2 cut(s) 68, 109
HaeIII GGCC 2 cut(s) 74, 96
Hin1II CATG 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 14
Hpy188III TCNNGA 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 108
HpyF3I CTNAG 1 cut(s) 124
Hsp92II CATG 1 cut(s) 43
Kzo9I GATC 2 cut(s) 14, 76
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 2 cut(s) 34, 56
Lsp1109I GCAGC 2 cut(s) 79, 120
MaeI CTAG 2 cut(s) 83, 98
MalI GATC 2 cut(s) 16, 78
MboI GATC 2 cut(s) 14, 76
MflI RGATCY 1 cut(s) 14
MluCI AATT 1 cut(s) 115
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 1 cut(s) 37
NdeII GATC 2 cut(s) 14, 76
NlaIII CATG 1 cut(s) 43
PceI AGGCCT 1 cut(s) 96
PkrI GCNGC 2 cut(s) 69, 110
PsuI RGATCY 1 cut(s) 14
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SatI GCNGC 2 cut(s) 68, 109
Sau3AI GATC 2 cut(s) 14, 76
SetI ASST 2 cut(s) 48, 113
SgeI CNNG 7 cut(s) 44, 52, 61, 75, 83, 95, 110
Sse9I AATT 1 cut(s) 115
SseBI AGGCCT 1 cut(s) 96
SspMI CTAG 2 cut(s) 83, 98
StuI AGGCCT 1 cut(s) 96
TasI AATT 1 cut(s) 115
TscAI CASTG 1 cut(s) 110
TseI GCWGC 2 cut(s) 67, 108
TspRI CASTG 1 cut(s) 110
XspI CTAG 2 cut(s) 83, 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.