Rh4CG282700

Ubiquitin carboxyl-terminal hydrolase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
54011849 .. 54012582
734 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG282700.1

Sequence Viewer

Length: 261 bp
ATGACTGAACTTTCGGTGGATGGATATGAAGCGGAGGTGTTCGAAGGTGGAGGGTACAAATGGAAACTGGTAATCTACCCAAATGGAAGCAAGAAAAGAAATGTGGCAGACCATATCTCCCTCTACTTGGAACTGGCTGGAGTAAATTCACTACAGAGTGATTGCGAAATATATGCTGATTTCAGATTCTTTTTACTTGATCGGAAAAAGGGCAAGTACTTAGTTGTTGAAGGTATTATCTATCTAAACCAGTTCAATTAA

Protein Analysis

86

Amino Acids

9.89

Weight (kDa)

5.28

Isoelectric Point (pI)

24.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MATH_2 PF22486 7 - 75 1.4e-15 MATH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AcsI RAATTY 1 cut(s) 145
AfaI GTAC 2 cut(s) 56, 218
AfiI CCNNNNNNNGG 1 cut(s) 127
AgsI TTSAA 2 cut(s) 230, 256
ApoI RAATTY 1 cut(s) 145
ArsI GACNNNNNNTTYG 1 cut(s) 27
AsuII TTCGAA 1 cut(s) 42
BccI CCATC 1 cut(s) 14
BcgI CGANNNNNNTGC 2 cut(s) 155, 189
BfmI CTRYAG 1 cut(s) 152
BmcAI AGTACT 1 cut(s) 218
BpmI CTGGAG 1 cut(s) 159
Bpu14I TTCGAA 1 cut(s) 42
BsaXI ACNNNNNCTCC 2 cut(s) 101, 131
Bsc4I CCNNNNNNNGG 1 cut(s) 127
Bse1I ACTGG 3 cut(s) 72, 138, 250
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 127
BseNI ACTGG 3 cut(s) 72, 138, 250
BslI CCNNNNNNNGG 1 cut(s) 127
Bsp119I TTCGAA 1 cut(s) 42
Bsp143I GATC 1 cut(s) 199
BspACI CCGC 1 cut(s) 32
BspT104I TTCGAA 1 cut(s) 42
BsrI ACTGG 3 cut(s) 72, 138, 250
BssMI GATC 1 cut(s) 199
BstBI TTCGAA 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 220
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 1 cut(s) 202
BstMBI GATC 1 cut(s) 199
BstSFI CTRYAG 1 cut(s) 152
BtsCI GGATG 1 cut(s) 25
Csp6I GTAC 2 cut(s) 55, 217
CviJI RGCY 1 cut(s) 137
CviKI_1 RGCY 1 cut(s) 137
CviQI GTAC 2 cut(s) 55, 217
DdeI CTNAG 1 cut(s) 220
DpnI GATC 1 cut(s) 201
DpnII GATC 1 cut(s) 199
FaiI YATR 4 cut(s) 27, 114, 172, 174
FokI GGATG 1 cut(s) 32
GsuI CTGGAG 1 cut(s) 159
HinfI GANTC 1 cut(s) 186
Hpy188I TCNGA 2 cut(s) 185, 204
HpyAV CCTTC 2 cut(s) 38, 224
HpyF3I CTNAG 1 cut(s) 220
Kzo9I GATC 1 cut(s) 199
LpnPI CCDG 3 cut(s) 53, 119, 123
MalI GATC 1 cut(s) 201
MboI GATC 1 cut(s) 199
MluCI AATT 2 cut(s) 145, 256
MnlI CCTC 3 cut(s) 28, 44, 131
MseI TTAA 1 cut(s) 259
NdeII GATC 1 cut(s) 199
NspV TTCGAA 1 cut(s) 42
PfeI GAWTC 1 cut(s) 186
RsaI GTAC 2 cut(s) 56, 218
RsaNI GTAC 2 cut(s) 55, 217
SaqAI TTAA 1 cut(s) 259
Sau3AI GATC 1 cut(s) 199
ScaI AGTACT 1 cut(s) 218
SetI ASST 3 cut(s) 39, 49, 235
SfcI CTRYAG 1 cut(s) 152
SfuI TTCGAA 1 cut(s) 42
SgeI CNNG 7 cut(s) 80, 103, 139, 146, 150, 209, 226
Sse9I AATT 2 cut(s) 145, 256
SsiI CCGC 1 cut(s) 32
TaqI TCGA 1 cut(s) 42
TasI AATT 2 cut(s) 145, 256
TatI WGTACW 1 cut(s) 216
TfiI GAWTC 1 cut(s) 186
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TspDTI ATGAA 1 cut(s) 42
XapI RAATTY 1 cut(s) 145
ZrmI AGTACT 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.