Rmu_sc0002268.1_g000004

Ubiquitin carboxyl-terminal hydrolase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002268.1
Physical Location & Seq
Forward (+)
15134 .. 15457
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002268.1_g000004.1.cds

Sequence Viewer

Length: 324 bp
atgcttgatgtttcgttttctgtgttggttagatacgaatcaacggagtttgaggcaggaggatacaggaggaaactagtgctcttcccaaatggaaacaaagaacgcaacgtggataaccacatctctctatacttggagatgtgcggagaaaaaactataagagccgggtacattatcacggtggattacaagttctttttgcttaatcaaaagtggaaaagctacctagttcttgaagatgtcaacaaaaaggagaagtattctatctataaaaccattgttggtggtttggctggttttgatcgattcatatccctctag

Protein Analysis

107

Amino Acids

12.51

Weight (kDa)

8.97

Isoelectric Point (pI)

21.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 147
AfaI GTAC 1 cut(s) 173
AgsI TTSAA 1 cut(s) 239
AhlI ACTAGT 1 cut(s) 76
AloI GAACNNNNNNTCC 2 cut(s) 179, 211
AluBI AGCT 1 cut(s) 225
AluI AGCT 1 cut(s) 225
Alw21I GWGCWC 1 cut(s) 84
AsuC2I CCSGG 1 cut(s) 169
Bbv12I GWGCWC 1 cut(s) 84
BciVI GTATCC 1 cut(s) 56
BcnI CCSGG 1 cut(s) 169
BcuI ACTAGT 1 cut(s) 76
BfaI CTAG 3 cut(s) 77, 230, 322
BfuI GTATCC 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 169
BmrFI CCNGG 1 cut(s) 169
BpuMI CCSGG 1 cut(s) 169
Bsa29I ATCGAT 1 cut(s) 307
BsaBI GATNNNNATC 2 cut(s) 37, 313
Bse8I GATNNNNATC 2 cut(s) 37, 313
BseCI ATCGAT 1 cut(s) 307
BseJI GATNNNNATC 2 cut(s) 37, 313
BshVI ATCGAT 1 cut(s) 307
BsiHKAI GWGCWC 1 cut(s) 84
BsiSI CCGG 1 cut(s) 168
Bsp1286I GDGCHC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 304
BspACI CCGC 1 cut(s) 147
BspDI ATCGAT 1 cut(s) 307
BspQI GCTCTTC 1 cut(s) 89
BssMI GATC 1 cut(s) 304
Bst4CI ACNGT 1 cut(s) 184
Bst6I CTCTTC 1 cut(s) 89
BstKTI GATC 1 cut(s) 307
BstMBI GATC 1 cut(s) 304
BstSCI CCNGG 1 cut(s) 167
Bsu15I ATCGAT 1 cut(s) 307
BsuI GTATCC 1 cut(s) 56
BsuTUI ATCGAT 1 cut(s) 307
ClaI ATCGAT 1 cut(s) 307
Csp6I GTAC 1 cut(s) 172
CviJI RGCY 3 cut(s) 167, 225, 296
CviKI_1 RGCY 3 cut(s) 167, 225, 296
CviQI GTAC 1 cut(s) 172
DpnI GATC 1 cut(s) 306
DpnII GATC 1 cut(s) 304
Eam1104I CTCTTC 1 cut(s) 89
EarI CTCTTC 1 cut(s) 89
FaiI YATR 4 cut(s) 133, 161, 273, 314
FspBI CTAG 3 cut(s) 77, 230, 322
HapII CCGG 1 cut(s) 168
HincII GTYRAC 1 cut(s) 247
HindII GTYRAC 1 cut(s) 247
HinfI GANTC 2 cut(s) 38, 309
HpaII CCGG 1 cut(s) 168
Hpy166II GTNNAC 1 cut(s) 247
Hpy188III TCNNGA 1 cut(s) 236
Hpy8I GTNNAC 1 cut(s) 247
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4IV ACGT 1 cut(s) 111
HpySE526I ACGT 1 cut(s) 111
Kzo9I GATC 1 cut(s) 304
LguI GCTCTTC 1 cut(s) 89
LpnPI CCDG 4 cut(s) 42, 52, 181, 282
MaeI CTAG 3 cut(s) 77, 230, 322
MaeII ACGT 1 cut(s) 111
MalI GATC 1 cut(s) 306
MboI GATC 1 cut(s) 304
MboII GAAGA 2 cut(s) 76, 251
MhlI GDGCHC 1 cut(s) 84
MnlI CCTC 3 cut(s) 46, 53, 63
MseI TTAA 1 cut(s) 207
MspI CCGG 1 cut(s) 168
MspR9I CCNGG 1 cut(s) 169
NciI CCSGG 1 cut(s) 169
NdeII GATC 1 cut(s) 304
PciSI GCTCTTC 1 cut(s) 89
PfeI GAWTC 2 cut(s) 38, 309
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
SapI GCTCTTC 1 cut(s) 89
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 1 cut(s) 304
ScrFI CCNGG 1 cut(s) 169
SduI GDGCHC 1 cut(s) 84
SetI ASST 3 cut(s) 114, 227, 231
SpeI ACTAGT 1 cut(s) 76
SsiI CCGC 1 cut(s) 147
SspMI CTAG 3 cut(s) 77, 230, 322
StyD4I CCNGG 1 cut(s) 167
TaaI ACNGT 1 cut(s) 184
TaiI ACGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 307
TfiI GAWTC 2 cut(s) 38, 309
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TspDTI ATGAA 1 cut(s) 301
TspGWI ACGGA 1 cut(s) 59
XspI CTAG 3 cut(s) 77, 230, 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.