RchiOBHm_Chr5g0006781

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
4211819 .. 4212390
572 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28788

Sequence Viewer

Length: 177 bp
ATGGAAGGTGCAAGGAGTGCTATGATCAACGGTGGGAACTTGAGTCAGAGGATTACTGCTCGTCTGATCCCAAAGAGGGGTCAGGTGAAGATGGCCATAGTGGGGATTCTGCTTCACTCTGTTTCTTCTATGTTCTCTCACCGTCGTGGTGGTGCTGATGCTCATCATTTCTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.26

Weight (kDa)

12.0

Isoelectric Point (pI)

33.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AcoI YGGCCR 1 cut(s) 93
AfiI CCNNNNNNNGG 3 cut(s) 76, 77, 102
AleI CACNNNNGTG 1 cut(s) 144
AlwI GGATC 1 cut(s) 61
AoxI GGCC 1 cut(s) 93
AsuHPI GGTGA 2 cut(s) 97, 131
BalI TGGCCA 1 cut(s) 95
BccI CCATC 1 cut(s) 85
BclI TGATCA 1 cut(s) 24
BmsI GCATC 1 cut(s) 148
BpuEI CTTGAG 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 162
Bsc4I CCNNNNNNNGG 3 cut(s) 76, 77, 102
Bse8I GATNNNNATC 1 cut(s) 162
BseJI GATNNNNATC 1 cut(s) 162
BseLI CCNNNNNNNGG 3 cut(s) 76, 77, 102
BshFI GGCC 1 cut(s) 95
BslI CCNNNNNNNGG 3 cut(s) 76, 77, 102
BsnI GGCC 1 cut(s) 95
Bsp143I GATC 2 cut(s) 24, 66
BspANI GGCC 1 cut(s) 95
BspPI GGATC 1 cut(s) 61
BssMI GATC 2 cut(s) 24, 66
Bst4CI ACNGT 2 cut(s) 32, 143
BstAPI GCANNNNNTGC 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 174
BstKTI GATC 2 cut(s) 27, 69
BstMBI GATC 2 cut(s) 24, 66
BstMWI GCNNNNNNNGC 1 cut(s) 17
BsuRI GGCC 1 cut(s) 95
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 26, 68
DpnII GATC 2 cut(s) 24, 66
EaeI YGGCCR 1 cut(s) 93
FaiI YATR 3 cut(s) 23, 98, 131
FbaI TGATCA 1 cut(s) 24
HaeIII GGCC 1 cut(s) 95
HinfI GANTC 2 cut(s) 43, 106
HphI GGTGA 2 cut(s) 97, 131
Hpy188I TCNGA 2 cut(s) 48, 66
Hpy99I CGWCG 1 cut(s) 147
HpyCH4III ACNGT 2 cut(s) 32, 143
HpyCH4V TGCA 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 174
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 2 cut(s) 24, 66
LpnPI CCDG 1 cut(s) 68
LweI GCATC 1 cut(s) 148
MalI GATC 2 cut(s) 26, 68
MboI GATC 2 cut(s) 24, 66
MboII GAAGA 2 cut(s) 100, 117
MlsI TGGCCA 1 cut(s) 95
MluNI TGGCCA 1 cut(s) 95
MlyI GAGTC 1 cut(s) 52
MnlI CCTC 2 cut(s) 42, 69
Mox20I TGGCCA 1 cut(s) 95
MscI TGGCCA 1 cut(s) 95
MslI CAYNNNNRTG 1 cut(s) 144
Msp20I TGGCCA 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 17
NdeII GATC 2 cut(s) 24, 66
OliI CACNNNNGTG 1 cut(s) 144
PfeI GAWTC 1 cut(s) 106
PleI GAGTC 1 cut(s) 51
PpsI GAGTC 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 144
Sau3AI GATC 2 cut(s) 24, 66
SchI GAGTC 1 cut(s) 52
SetI ASST 2 cut(s) 10, 87
SfaNI GCATC 1 cut(s) 148
SgeI CNNG 5 cut(s) 24, 52, 72, 95, 158
SmiMI CAYNNNNRTG 1 cut(s) 144
SmlI CTYRAG 1 cut(s) 40
SmoI CTYRAG 1 cut(s) 40
TaaI ACNGT 2 cut(s) 32, 143
TfiI GAWTC 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.