RchiOBHm_Chr5g0010491

Uncharacterised protein family UPF0052

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0013634
Physical Location & Seq
Reverse (-)
6924412 .. 6927432
3021 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29123

Sequence Viewer

Length: 264 bp
ATGGTTCAGCTACGTAATGTGGATTGCATTGTTTATGCCATGGCATGGGTTAATTCCCTCTTTACTTCTGTTTGCCCATCACTGGCATTAATTGGCATTGGGAAGATTATATGTTCAAGCCAGGTCCTGCCGCAAGCCCGCAAGATTGTTGTTGACTCTGTACATGATCCAAAAGTGGTTGTGGTATTTGACCCCAAGTCGTTAATACAAGCCCTTGATGATTTGGTAGGCAGACACATGACTACAAATGTTAAGGTTGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UPF0052

Protein Analysis

87

Amino Acids

9.5

Weight (kDa)

8.57

Isoelectric Point (pI)

19.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 45
AciI CCGC 2 cut(s) 131, 139
AclWI GGATC 1 cut(s) 161
AfaI GTAC 1 cut(s) 162
AfiI CCNNNNNNNGG 2 cut(s) 45, 82
AgsI TTSAA 1 cut(s) 117
AhdI GACNNNNNGTC 1 cut(s) 196
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
AlwI GGATC 1 cut(s) 161
AlwNI CAGNNNCTG 1 cut(s) 127
AseI ATTAAT 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 124
AvaII GGWCC 1 cut(s) 124
BccI CCATC 1 cut(s) 85
BciT130I CCWGG 1 cut(s) 122
BisI GCNGC 1 cut(s) 131
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 122
Bme18I GGWCC 1 cut(s) 124
BmeRI GACNNNNNGTC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 124
BmrFI CCNGG 1 cut(s) 122
BsaAI YACGTR 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 2 cut(s) 45, 82
Bse1I ACTGG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 39
BseLI CCNNNNNNNGG 2 cut(s) 45, 82
BseNI ACTGG 1 cut(s) 87
BslI CCNNNNNNNGG 2 cut(s) 45, 82
Bsp1407I TGTACA 1 cut(s) 160
Bsp143I GATC 1 cut(s) 166
Bsp19I CCATGG 1 cut(s) 39
BspACI CCGC 2 cut(s) 131, 139
BspPI GGATC 1 cut(s) 161
BsrGI TGTACA 1 cut(s) 160
BsrI ACTGG 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 1 cut(s) 166
BssT1I CCWWGG 1 cut(s) 39
Bst2UI CCWGG 1 cut(s) 122
BstAUI TGTACA 1 cut(s) 160
BstBAI YACGTR 1 cut(s) 14
BstC8I GCNNGC 2 cut(s) 135, 139
BstDSI CCRYGG 1 cut(s) 39
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstNI CCWGG 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 120
BstSNI TACGTA 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 80
Cac8I GCNNGC 2 cut(s) 135, 139
CaiI CAGNNNCTG 1 cut(s) 127
Cfr13I GGNCC 1 cut(s) 124
Csp6I GTAC 1 cut(s) 161
CviAII CATG 4 cut(s) 40, 45, 164, 238
CviJI RGCY 4 cut(s) 10, 120, 137, 212
CviKI_1 RGCY 4 cut(s) 10, 120, 137, 212
CviQI GTAC 1 cut(s) 161
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
DriI GACNNNNNGTC 1 cut(s) 196
Eam1105I GACNNNNNGTC 1 cut(s) 196
Eco105I TACGTA 1 cut(s) 14
Eco130I CCWWGG 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 124
EcoO109I RGGNCCY 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaeI CATG 4 cut(s) 43, 48, 167, 241
FaiI YATR 7 cut(s) 36, 41, 46, 110, 112, 165, 239
FatI CATG 4 cut(s) 39, 44, 163, 237
FauI CCCGC 1 cut(s) 146
Fnu4HI GCNGC 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 131
GluI GCNGC 1 cut(s) 131
Hin1II CATG 4 cut(s) 43, 48, 167, 241
HincII GTYRAC 1 cut(s) 154
HindII GTYRAC 1 cut(s) 154
HinfI GANTC 1 cut(s) 155
Hpy166II GTNNAC 1 cut(s) 154
Hpy8I GTNNAC 1 cut(s) 154
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 13
Hsp92II CATG 4 cut(s) 43, 48, 167, 241
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 4 cut(s) 68, 107, 134, 140
MaeII ACGT 1 cut(s) 13
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 115
MluCI AATT 2 cut(s) 52, 90
MlyI GAGTC 1 cut(s) 149
MnlI CCTC 1 cut(s) 68
MseI TTAA 4 cut(s) 51, 89, 203, 252
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
NcoI CCATGG 1 cut(s) 39
NdeII GATC 1 cut(s) 166
NlaIII CATG 4 cut(s) 43, 48, 167, 241
PflMI CCANNNNNTGG 1 cut(s) 45
PkrI GCNGC 1 cut(s) 132
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
Ppu21I YACGTR 1 cut(s) 14
PpuMI RGGWCCY 1 cut(s) 124
PshBI ATTAAT 1 cut(s) 89
Psp5II RGGWCCY 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PspPI GGNCC 1 cut(s) 124
PspPPI RGGWCCY 1 cut(s) 124
PstNI CAGNNNCTG 1 cut(s) 127
RsaI GTAC 1 cut(s) 162
RsaNI GTAC 1 cut(s) 161
SaqAI TTAA 4 cut(s) 51, 89, 203, 252
SatI GCNGC 1 cut(s) 131
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 124
SchI GAGTC 1 cut(s) 149
ScrFI CCNGG 1 cut(s) 122
SetI ASST 4 cut(s) 12, 16, 126, 258
SinI GGWCC 1 cut(s) 124
SnaBI TACGTA 1 cut(s) 14
Sse9I AATT 2 cut(s) 52, 90
SsiI CCGC 2 cut(s) 131, 139
StyD4I CCNGG 1 cut(s) 120
StyI CCWWGG 1 cut(s) 39
TaiI ACGT 1 cut(s) 16
TasI AATT 2 cut(s) 52, 90
TatI WGTACW 1 cut(s) 160
TauI GCSGC 1 cut(s) 133
Tru1I TTAA 4 cut(s) 51, 89, 203, 252
Tru9I TTAA 4 cut(s) 51, 89, 203, 252
TscAI CASTG 1 cut(s) 87
TspRI CASTG 1 cut(s) 87
Van91I CCANNNNNTGG 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 124
VspI ATTAAT 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.