Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5D

Orthogroup ID

OG0013634

Physical Location & Seq

Genomic Coordinates Reverse (-)

6801819 .. 6802559

Gene Structure 741 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5DG077300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGGTTCAGCTACGTAATGTGGATTGCATTGTTTATGCCATGGCATGGGTTAATTCCCTCTTTACTTCTGTTTGCCCATCACTGGCATTAATTGGCATTGGGAAGATTATATGTTCAAGGCCAGGTCCTGCCGCAAGGTACTTTTGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UPF0052

Protein Analysis

49

Amino Acids

5.35

Weight (kDa)

8.91

Isoelectric Point (pI)

28.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013634)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g07940 FvH4_4g20380
rosa_chinensis	RchiOBHm_Chr5g0010491 RchiOBHm_Chr5g0010591
rosa_multiflora	Rmu_sc0000685.1_g000021 Rmu_sc0001287.1_g000008 Rmu_sc0003480.1_g000017 Rmu_sc0015162.1_g000001 Rmu_sc0015466.1_g000005
rosa_roxburghii	Rroxscaffold_1G00000820 Rroxscaffold_4G00325250
rosa_samantha	Rh5AG082100 Rh5AG082500 Rh5AG082600 Rh5CG090100 Rh5CG090400 Rh5DG077300 Rh5DG078000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	45
AciI	CCGC	1 cut(s)	132
AfaI	GTAC	1 cut(s)	140
AfiI	CCNNNNNNNGG	2 cut(s)	45, 82
AgsI	TTSAA	1 cut(s)	117
AjnI	CCWGG	1 cut(s)	121
AluBI	AGCT	1 cut(s)	10
AluI	AGCT	1 cut(s)	10
AlwNI	CAGNNNCTG	1 cut(s)	128
AoxI	GGCC	1 cut(s)	119
AseI	ATTAAT	1 cut(s)	89
AspS9I	GGNCC	1 cut(s)	125
AvaII	GGWCC	1 cut(s)	125
BaeI	ACNNNNGTAYC	1 cut(s)	130
BccI	CCATC	1 cut(s)	85
BciT130I	CCWGG	1 cut(s)	123
BisI	GCNGC	1 cut(s)	132
BlsI	GCNGC	1 cut(s)	133
Bme1390I	CCNGG	1 cut(s)	123
Bme18I	GGWCC	1 cut(s)	125
BmgT120I	GGNCC	1 cut(s)	125
BmrFI	CCNGG	1 cut(s)	123
BsaAI	YACGTR	1 cut(s)	14
BsaJI	CCNNGG	1 cut(s)	39
Bsc4I	CCNNNNNNNGG	2 cut(s)	45, 82
Bse1I	ACTGG	1 cut(s)	87
BseBI	CCWGG	1 cut(s)	123
BseDI	CCNNGG	1 cut(s)	39
BseLI	CCNNNNNNNGG	2 cut(s)	45, 82
BseNI	ACTGG	1 cut(s)	87
BshFI	GGCC	1 cut(s)	121
BslI	CCNNNNNNNGG	2 cut(s)	45, 82
BsnI	GGCC	1 cut(s)	121
Bsp19I	CCATGG	1 cut(s)	39
BspACI	CCGC	1 cut(s)	132
BspANI	GGCC	1 cut(s)	121
BsrI	ACTGG	1 cut(s)	87
BssECI	CCNNGG	1 cut(s)	39
BssT1I	CCWWGG	1 cut(s)	39
Bst2UI	CCWGG	1 cut(s)	123
BstBAI	YACGTR	1 cut(s)	14
BstDSI	CCRYGG	1 cut(s)	39
BstNI	CCWGG	1 cut(s)	123
BstSCI	CCNGG	1 cut(s)	121
BstSNI	TACGTA	1 cut(s)	14
BsuRI	GGCC	1 cut(s)	121
BtgI	CCRYGG	1 cut(s)	39
BtsIMutI	CAGTG	1 cut(s)	80
CaiI	CAGNNNCTG	1 cut(s)	128
Cfr13I	GGNCC	1 cut(s)	125
Csp6I	GTAC	1 cut(s)	139
CviAII	CATG	2 cut(s)	40, 45
CviJI	RGCY	2 cut(s)	10, 121
CviKI_1	RGCY	2 cut(s)	10, 121
CviQI	GTAC	1 cut(s)	139
Eco105I	TACGTA	1 cut(s)	14
Eco130I	CCWWGG	1 cut(s)	39
Eco47I	GGWCC	1 cut(s)	125
EcoO109I	RGGNCCY	1 cut(s)	125
EcoRII	CCWGG	1 cut(s)	121
EcoT14I	CCWWGG	1 cut(s)	39
ErhI	CCWWGG	1 cut(s)	39
FaeI	CATG	2 cut(s)	43, 48
FaiI	YATR	5 cut(s)	36, 41, 46, 110, 112
FatI	CATG	2 cut(s)	39, 44
Fnu4HI	GCNGC	1 cut(s)	132
Fsp4HI	GCNGC	1 cut(s)	132
GluI	GCNGC	1 cut(s)	132
HaeIII	GGCC	1 cut(s)	121
Hin1II	CATG	2 cut(s)	43, 48
HpyCH4IV	ACGT	1 cut(s)	13
HpyCH4V	TGCA	1 cut(s)	27
HpySE526I	ACGT	1 cut(s)	13
Hsp92II	CATG	2 cut(s)	43, 48
LpnPI	CCDG	4 cut(s)	68, 108, 135, 141
MaeII	ACGT	1 cut(s)	13
MboII	GAAGA	1 cut(s)	115
MluCI	AATT	2 cut(s)	52, 90
MnlI	CCTC	1 cut(s)	68
MseI	TTAA	3 cut(s)	51, 89, 148
MspR9I	CCNGG	1 cut(s)	123
MvaI	CCWGG	1 cut(s)	123
NcoI	CCATGG	1 cut(s)	39
NlaIII	CATG	2 cut(s)	43, 48
PflMI	CCANNNNNTGG	1 cut(s)	45
PkrI	GCNGC	1 cut(s)	133
Ppu21I	YACGTR	1 cut(s)	14
PpuMI	RGGWCCY	1 cut(s)	125
PshBI	ATTAAT	1 cut(s)	89
Psp5II	RGGWCCY	1 cut(s)	125
Psp6I	CCWGG	1 cut(s)	121
PspGI	CCWGG	1 cut(s)	121
PspPI	GGNCC	1 cut(s)	125
PspPPI	RGGWCCY	1 cut(s)	125
PstNI	CAGNNNCTG	1 cut(s)	128
RsaI	GTAC	1 cut(s)	140
RsaNI	GTAC	1 cut(s)	139
SaqAI	TTAA	3 cut(s)	51, 89, 148
SatI	GCNGC	1 cut(s)	132
Sau96I	GGNCC	1 cut(s)	125
ScrFI	CCNGG	1 cut(s)	123
SetI	ASST	4 cut(s)	12, 16, 127, 140
SgeI	CNNG	7 cut(s)	52, 57, 95, 129, 134, 135, 140
SinI	GGWCC	1 cut(s)	125
SnaBI	TACGTA	1 cut(s)	14
Sse9I	AATT	2 cut(s)	52, 90
SsiI	CCGC	1 cut(s)	132
StyD4I	CCNGG	1 cut(s)	121
StyI	CCWWGG	1 cut(s)	39
TaiI	ACGT	1 cut(s)	16
TasI	AATT	2 cut(s)	52, 90
TauI	GCSGC	1 cut(s)	134
Tru1I	TTAA	3 cut(s)	51, 89, 148
Tru9I	TTAA	3 cut(s)	51, 89, 148
TscAI	CASTG	1 cut(s)	87
TspRI	CASTG	1 cut(s)	87
Van91I	CCANNNNNTGG	1 cut(s)	45
VpaK11BI	GGWCC	1 cut(s)	125
VspI	ATTAAT	1 cut(s)	89

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.