Rmu_sc0015162.1_g000001

CCAAT enhancer-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015162.1
Physical Location & Seq
Reverse (-)
1 .. 7733
7733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015162.1_g000001.1.cds

Sequence Viewer

Length: 1104 bp
atgtatggttttcttcaatatgactactttaatgaagaagaccccagaagactgtgggtctcactcaaagaacattttgggaatgtcagtgactccctgcttcttgactttgtagtgagatggcataatctccgcttctatgatttcaagattgttcttgattacaactcagaagcactttgcatcacatatagagagaagtcaccttccaccttgctgtgctacggtgaccagtggccggcgcggtctccggcgaccagactccggcgaccggtgacaggactccggcgaacggtgaccggactccagcgaatggtgaccggattccgacgaccgaaccgaaacacccagaattccaaaccccaaaatcgaaacaccacccagaacttcaaacccaatgaaaggcccaatctttcgaaaccccattttccttcactccctgatgtcaccagcaacagtgaaaaagcaaagacctttgagaatcttccgaagctgccgttgatttcagctaccaacattggagtttggtacgaagaagctgaagatttggaaggcaaaatggtcgggaagatgaagaaagccgaggcaaggagtgacaaggagtggcgatggtcgggatcgccgatcaatcgaacggcgaagaggacgttggagtggctcgatcgccgatcattcgaacgacgacgagaacgttggatcgctgactggagcttcattgtcgtcttcaggtttggactgcatctccggcccggcgatcagagagagagagacagaccggaggaggagaattcagttgcgtctaacaagctcggtggcacgctgtcaggtggccggaggaaggagatacggttgagcatcctggtaaaactgaaggattgcttgacaaagtttcaggcatatctcattgtagagtttcaggataactaccgagttggagattacttggacattgatcaagtctgggttgaatgggcaagcatgctgtcaagtttcagatcactagtgttgtatgtctatggtagatcactatgtgcaatatctagataccatgagcttagtatgtttatgaattggcatcctctgcagctggctttgcttatctcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

368

Amino Acids

43.47

Weight (kDa)

9.65

Isoelectric Point (pI)

55.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 313
AccII CGCG 1 cut(s) 244
AciI CCGC 2 cut(s) 133, 244
AclI AACGTT 1 cut(s) 691
AclWI GGATC 2 cut(s) 625, 704
AcoI YGGCCR 2 cut(s) 236, 829
AcsI RAATTY 2 cut(s) 352, 787
AcuI CTGAAG 3 cut(s) 561, 709, 890
AdeI CACNNNGTG 1 cut(s) 1031
AfaI GTAC 1 cut(s) 530
AfiI CCNNNNNNNGG 9 cut(s) 238, 264, 271, 278, 292, 313, 402, 588, 838
AgeI ACCGGT 1 cut(s) 271
AgsI TTSAA 4 cut(s) 17, 148, 391, 968
AhdI GACNNNNNGTC 1 cut(s) 56
AhlI ACTAGT 1 cut(s) 1000
AjnI CCWGG 1 cut(s) 858
AjuI GAANNNNNNNTTGG 2 cut(s) 632, 664
AluBI AGCT 7 cut(s) 493, 509, 539, 711, 808, 1054, 1087
AluI AGCT 7 cut(s) 493, 509, 539, 711, 808, 1054, 1087
Alw26I GTCTC 3 cut(s) 64, 252, 762
AlwI GGATC 2 cut(s) 625, 704
AoxI GGCC 4 cut(s) 236, 404, 746, 829
ApeKI GCWGC 2 cut(s) 493, 1084
ApoI RAATTY 2 cut(s) 352, 787
AsiGI ACCGGT 1 cut(s) 271
AspLEI GCGC 1 cut(s) 244
AspS9I GGNCC 2 cut(s) 405, 747
AsuC2I CCSGG 1 cut(s) 750
AsuHPI GGTGA 6 cut(s) 195, 239, 286, 307, 328, 439
AsuII TTCGAA 2 cut(s) 416, 675
BbsI GAAGAC 3 cut(s) 45, 55, 715
BbvI GCAGC 2 cut(s) 480, 1096
BccI CCATC 2 cut(s) 114, 603
BceAI ACGGC 2 cut(s) 481, 651
BcgI CGANNNNNNTGC 2 cut(s) 544, 578
BciT130I CCWGG 1 cut(s) 860
BclI TGATCA 1 cut(s) 952
BcnI CCSGG 1 cut(s) 750
BcoDI GTCTC 3 cut(s) 64, 252, 762
BcuI ACTAGT 1 cut(s) 1000
BfaI CTAG 2 cut(s) 1001, 1041
BfmI CTRYAG 1 cut(s) 1082
BisI GCNGC 2 cut(s) 494, 1085
BlsI GCNGC 2 cut(s) 495, 1086
Bme1390I CCNGG 2 cut(s) 750, 860
BmeRI GACNNNNNGTC 1 cut(s) 56
BmgT120I GGNCC 2 cut(s) 405, 747
BmrFI CCNGG 2 cut(s) 750, 860
BmsI GCATC 4 cut(s) 192, 748, 864, 1084
BpiI GAAGAC 3 cut(s) 45, 55, 715
BpmI CTGGAG 2 cut(s) 290, 727
Bpu14I TTCGAA 2 cut(s) 416, 675
BpuMI CCSGG 1 cut(s) 750
BsaI GGTCTC 2 cut(s) 64, 252
BsaJI CCNNGG 1 cut(s) 582
BsaWI WCCGGW 4 cut(s) 271, 299, 320, 775
BsaXI ACNNNNNCTCC 4 cut(s) 726, 756, 833, 863
Bsc4I CCNNNNNNNGG 9 cut(s) 238, 264, 271, 278, 292, 313, 402, 588, 838
Bse118I RCCGGY 2 cut(s) 238, 271
Bse1I ACTGG 2 cut(s) 232, 710
BseBI CCWGG 1 cut(s) 860
BseDI CCNNGG 1 cut(s) 582
BseGI GGATG 2 cut(s) 855, 1075
BseLI CCNNNNNNNGG 9 cut(s) 238, 264, 271, 278, 292, 313, 402, 588, 838
BseMII CTCAG 1 cut(s) 183
BseNI ACTGG 2 cut(s) 232, 710
BseRI GAGGAG 2 cut(s) 794, 797
BseXI GCAGC 2 cut(s) 480, 1096
Bsh1236I CGCG 1 cut(s) 244
Bsh1285I CGRYCG 3 cut(s) 272, 335, 664
BshFI GGCC 4 cut(s) 238, 406, 748, 831
BshTI ACCGGT 1 cut(s) 271
BsiEI CGRYCG 3 cut(s) 272, 335, 664
BslI CCNNNNNNNGG 9 cut(s) 238, 264, 271, 278, 292, 313, 402, 588, 838
BsmAI GTCTC 3 cut(s) 64, 252, 762
BsnI GGCC 4 cut(s) 238, 406, 748, 831
Bso31I GGTCTC 2 cut(s) 64, 252
Bsp119I TTCGAA 2 cut(s) 416, 675
Bsp143I GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
BspACI CCGC 2 cut(s) 133, 244
BspANI GGCC 4 cut(s) 238, 406, 748, 831
BspCNI CTCAG 1 cut(s) 182
BspFNI CGCG 1 cut(s) 244
BspMAI CTGCAG 1 cut(s) 1086
BspPI GGATC 2 cut(s) 625, 704
BspT104I TTCGAA 2 cut(s) 416, 675
BspTNI GGTCTC 2 cut(s) 64, 252
BsrFI RCCGGY 2 cut(s) 238, 271
BsrI ACTGG 2 cut(s) 232, 710
BssAI RCCGGY 2 cut(s) 238, 271
BssECI CCNNGG 1 cut(s) 582
BssMI GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
Bst2UI CCWGG 1 cut(s) 860
Bst4CI ACNGT 5 cut(s) 54, 227, 295, 458, 849
Bst6I CTCTTC 1 cut(s) 635
BstAPI GCANNNNNTGC 1 cut(s) 1081
BstBI TTCGAA 2 cut(s) 416, 675
BstC8I GCNNGC 5 cut(s) 240, 818, 976, 980, 1089
BstDEI CTNAG 2 cut(s) 169, 1055
BstEII GGTNACC 3 cut(s) 227, 295, 316
BstF5I GGATG 2 cut(s) 855, 1075
BstFNI CGCG 1 cut(s) 244
BstHHI GCGC 1 cut(s) 244
BstKTI GATC 9 cut(s) 620, 627, 664, 671, 699, 757, 955, 998, 1025
BstMAI GTCTC 3 cut(s) 64, 252, 762
BstMBI GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
BstMCI CGRYCG 3 cut(s) 272, 335, 664
BstMWI GCNNNNNNNGC 3 cut(s) 745, 1081, 1093
BstNI CCWGG 1 cut(s) 860
BstNSI RCATGY 1 cut(s) 982
BstPI GGTNACC 3 cut(s) 227, 295, 316
BstSCI CCNGG 2 cut(s) 748, 858
BstSFI CTRYAG 1 cut(s) 1082
BstUI CGCG 1 cut(s) 244
BstV1I GCAGC 2 cut(s) 480, 1096
BstV2I GAAGAC 3 cut(s) 45, 55, 715
BsuRI GGCC 4 cut(s) 238, 406, 748, 831
BtgZI GCGATG 1 cut(s) 622
BtsCI GGATG 2 cut(s) 855, 1075
BtsIMutI CAGTG 3 cut(s) 94, 239, 463
Cac8I GCNNGC 5 cut(s) 240, 818, 976, 980, 1089
CfoI GCGC 1 cut(s) 244
Cfr10I RCCGGY 2 cut(s) 238, 271
Cfr13I GGNCC 2 cut(s) 405, 747
CseI GACGC 1 cut(s) 786
Csp6I GTAC 1 cut(s) 529
CspAI ACCGGT 1 cut(s) 271
CspCI CAANNNNNGTGG 2 cut(s) 793, 828
CviAII CATG 2 cut(s) 979, 1049
CviQI GTAC 1 cut(s) 529
DdeI CTNAG 2 cut(s) 169, 1055
DpnI GATC 9 cut(s) 619, 626, 663, 670, 698, 756, 954, 997, 1024
DpnII GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
DraIII CACNNNGTG 1 cut(s) 1031
DriI GACNNNNNGTC 1 cut(s) 56
EaeI YGGCCR 2 cut(s) 236, 829
Eam1104I CTCTTC 1 cut(s) 635
Eam1105I GACNNNNNGTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 635
Eco31I GGTCTC 2 cut(s) 64, 252
Eco57I CTGAAG 3 cut(s) 561, 709, 890
Eco91I GGTNACC 3 cut(s) 227, 295, 316
EcoO65I GGTNACC 3 cut(s) 227, 295, 316
EcoRI GAATTC 2 cut(s) 352, 787
EcoRII CCWGG 1 cut(s) 858
FaeI CATG 2 cut(s) 982, 1052
FalI AAGNNNNNCTT 2 cut(s) 863, 895
FatI CATG 2 cut(s) 978, 1048
FbaI TGATCA 1 cut(s) 952
Fnu4HI GCNGC 2 cut(s) 494, 1085
FokI GGATG 2 cut(s) 842, 1062
Fsp4HI GCNGC 2 cut(s) 494, 1085
FspBI CTAG 2 cut(s) 1001, 1041
GlaI GCGC 1 cut(s) 243
GluI GCNGC 2 cut(s) 494, 1085
GsuI CTGGAG 2 cut(s) 290, 727
HaeIII GGCC 4 cut(s) 238, 406, 748, 831
HgaI GACGC 1 cut(s) 786
HhaI GCGC 1 cut(s) 244
Hin1II CATG 2 cut(s) 982, 1052
Hin6I GCGC 1 cut(s) 242
HinP1I GCGC 1 cut(s) 242
HinfI GANTC 6 cut(s) 92, 261, 282, 303, 324, 481
HphI GGTGA 6 cut(s) 195, 239, 286, 307, 328, 439
Hpy188I TCNGA 5 cut(s) 172, 329, 489, 759, 995
Hpy188III TCNNGA 7 cut(s) 104, 148, 158, 565, 615, 917, 1041
Hpy99I CGWCG 3 cut(s) 333, 684, 687
HpyAV CCTTC 5 cut(s) 216, 441, 545, 832, 865
HpyCH4III ACNGT 5 cut(s) 54, 227, 295, 458, 849
HpyCH4IV ACGT 2 cut(s) 647, 691
HpyCH4V TGCA 4 cut(s) 183, 739, 1034, 1084
HpyF10VI GCNNNNNNNGC 3 cut(s) 745, 1081, 1093
HpyF3I CTNAG 2 cut(s) 169, 1055
HpySE526I ACGT 2 cut(s) 647, 691
Hsp92II CATG 2 cut(s) 982, 1052
HspAI GCGC 1 cut(s) 242
KroI GCCGGC 1 cut(s) 238
KroNI GCCGGC 1 cut(s) 240
Ksp22I TGATCA 1 cut(s) 952
Kzo9I GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
LmnI GCTCC 1 cut(s) 708
Lsp1109I GCAGC 2 cut(s) 480, 1096
LweI GCATC 4 cut(s) 192, 748, 864, 1084
MaeI CTAG 2 cut(s) 1001, 1041
MaeII ACGT 2 cut(s) 647, 691
MaeIII GTNAC 8 cut(s) 89, 201, 227, 274, 295, 316, 445, 593
MalI GATC 9 cut(s) 619, 626, 663, 670, 698, 756, 954, 997, 1024
MboI GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
MluCI AATT 3 cut(s) 352, 787, 1069
MlyI GAGTC 4 cut(s) 86, 255, 276, 297
MmeI TCCRAC 4 cut(s) 352, 630, 674, 913
MnlI CCTC 6 cut(s) 577, 636, 772, 775, 828, 1089
MroNI GCCGGC 1 cut(s) 238
MseI TTAA 1 cut(s) 30
MspA1I CMGCKG 1 cut(s) 1087
MspR9I CCNGG 2 cut(s) 750, 860
MvaI CCWGG 1 cut(s) 860
MvnI CGCG 1 cut(s) 244
MwoI GCNNNNNNNGC 3 cut(s) 745, 1081, 1093
NaeI GCCGGC 1 cut(s) 240
NciI CCSGG 1 cut(s) 750
NdeII GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
NgoMIV GCCGGC 1 cut(s) 238
NlaIII CATG 2 cut(s) 982, 1052
NmeAIII GCCGAG 1 cut(s) 607
NmuCI GTSAC 8 cut(s) 89, 201, 227, 274, 295, 316, 445, 593
NspI RCATGY 1 cut(s) 982
NspV TTCGAA 2 cut(s) 416, 675
PaeI GCATGC 1 cut(s) 982
PcsI WCGNNNNNNNCGW 3 cut(s) 337, 620, 688
PdiI GCCGGC 1 cut(s) 240
PfeI GAWTC 2 cut(s) 324, 481
PflMI CCANNNNNTGG 1 cut(s) 313
PinAI ACCGGT 1 cut(s) 271
PkrI GCNGC 2 cut(s) 495, 1086
Ple19I CGATCG 1 cut(s) 664
PleI GAGTC 4 cut(s) 86, 255, 276, 297
PpsI GAGTC 4 cut(s) 86, 255, 276, 297
Psp1406I AACGTT 1 cut(s) 691
Psp6I CCWGG 1 cut(s) 858
PspEI GGTNACC 3 cut(s) 227, 295, 316
PspGI CCWGG 1 cut(s) 858
PspPI GGNCC 2 cut(s) 405, 747
PstI CTGCAG 1 cut(s) 1086
PvuI CGATCG 1 cut(s) 664
PvuII CAGCTG 1 cut(s) 1087
RsaI GTAC 1 cut(s) 530
RsaNI GTAC 1 cut(s) 529
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 2 cut(s) 494, 1085
Sau3AI GATC 9 cut(s) 617, 624, 661, 668, 696, 754, 952, 995, 1022
Sau96I GGNCC 2 cut(s) 405, 747
SchI GAGTC 4 cut(s) 86, 255, 276, 297
ScrFI CCNGG 2 cut(s) 750, 860
SfaNI GCATC 4 cut(s) 192, 748, 864, 1084
SfcI CTRYAG 1 cut(s) 1082
SfuI TTCGAA 2 cut(s) 416, 675
SpeI ACTAGT 1 cut(s) 1000
SphI GCATGC 1 cut(s) 982
Sse9I AATT 3 cut(s) 352, 787, 1069
SsiI CCGC 2 cut(s) 133, 244
SspMI CTAG 2 cut(s) 1001, 1041
StyD4I CCNGG 2 cut(s) 748, 858
TaaI ACNGT 5 cut(s) 54, 227, 295, 458, 849
TaiI ACGT 2 cut(s) 650, 694
TaqI TCGA 5 cut(s) 370, 416, 631, 660, 675
TaqII GACCGA 1 cut(s) 349
TasI AATT 3 cut(s) 352, 787, 1069
TfiI GAWTC 2 cut(s) 324, 481
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TscAI CASTG 3 cut(s) 94, 239, 463
TseFI GTSAC 8 cut(s) 89, 201, 227, 274, 295, 316, 445, 593
TseI GCWGC 2 cut(s) 493, 1084
Tsp45I GTSAC 8 cut(s) 89, 201, 227, 274, 295, 316, 445, 593
TspDTI ATGAA 5 cut(s) 48, 414, 587, 703, 1082
TspRI CASTG 3 cut(s) 94, 239, 463
Van91I CCANNNNNTGG 1 cut(s) 313
XapI RAATTY 2 cut(s) 352, 787
XbaI TCTAGA 1 cut(s) 1040
XceI RCATGY 1 cut(s) 982
XspI CTAG 2 cut(s) 1001, 1041
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.