Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001287.1

Orthogroup ID

OG0013634

Physical Location & Seq

Genomic Coordinates Reverse (-)

57732 .. 59290

Gene Structure 1559 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001287.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 681 bp

atgatggtggtgaattccaaaccccaaaatcgaaacaccacccagaacttcaaacccaatgaaaggcccaatctttcgaaaccccattttccttcactccctgatgtcaccagcaacagtgaaaaagcaaagacctttgagaatcttccgaagctgccgttgatttcagccaccaacattggagtttggtacgaagaagctgaagatttggaaggcaaagtggtcgggaagatgaagaaagccgaggcaaggagtgacaaggagtggcgatggtcgggatcgccgatcaatcgaacggcgacgaggacgttggagtggctggatcgccgatcattcgaacgacgacgagaacgttggatcgccgactggagcttcatcgtcgtcttcaggtttgaactacatctccgacgcggcgatcagagagagacagacagaccggaggtggagatcatggggaggagagagagagagagagagtggagaggcccaaaggcccactgcccaaaccctatgtccccaacacctagccagccgaatctaactctttcgagaagccgcctaccaccacctaatcaatccggatggcctccccatgcaggagaccatggagaccatctcgccgccctccaaacctgtgcttgtgactgcactcacagcaacaggccaatccttcaagcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CBF

Protein Analysis

226

Amino Acids

26.19

Weight (kDa)

9.6

Isoelectric Point (pI)

63.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013634)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g07940 FvH4_4g20380
rosa_chinensis	RchiOBHm_Chr5g0010491 RchiOBHm_Chr5g0010591
rosa_multiflora	Rmu_sc0000685.1_g000021 Rmu_sc0001287.1_g000008 Rmu_sc0003480.1_g000017 Rmu_sc0015162.1_g000001 Rmu_sc0015466.1_g000005
rosa_roxburghii	Rroxscaffold_1G00000820 Rroxscaffold_4G00325250
rosa_samantha	Rh5AG082100 Rh5AG082500 Rh5AG082600 Rh5CG090100 Rh5CG090400 Rh5DG077300 Rh5DG078000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	411
AccIII	TCCGGA	1 cut(s)	578
AciI	CCGC	3 cut(s)	411, 556, 621
AclI	AACGTT	1 cut(s)	352
AclWI	GGATC	3 cut(s)	286, 330, 365
AcsI	RAATTY	1 cut(s)	13
AcuI	CTGAAG	2 cut(s)	222, 370
AfaI	GTAC	1 cut(s)	191
AfiI	CCNNNNNNNGG	3 cut(s)	63, 249, 596
AgsI	TTSAA	3 cut(s)	52, 395, 674
AloI	GAACNNNNNNTCC	2 cut(s)	387, 419
AluBI	AGCT	4 cut(s)	154, 200, 372, 677
AluI	AGCT	4 cut(s)	154, 200, 372, 677
Alw26I	GTCTC	3 cut(s)	419, 594, 603
AlwI	GGATC	3 cut(s)	286, 330, 365
Aor13HI	TCCGGA	1 cut(s)	578
AoxI	GGCC	5 cut(s)	65, 484, 492, 584, 662
ApeKI	GCWGC	1 cut(s)	154
ApoI	RAATTY	1 cut(s)	13
ArsI	GACNNNNNNTTYG	2 cut(s)	497, 529
AspS9I	GGNCC	3 cut(s)	66, 485, 493
AsuHPI	GGTGA	2 cut(s)	22, 100
AsuII	TTCGAA	2 cut(s)	77, 336
BbsI	GAAGAC	1 cut(s)	376
BbvI	GCAGC	1 cut(s)	141
BccI	CCATC	3 cut(s)	264, 576, 621
BceAI	ACGGC	2 cut(s)	142, 312
BcgI	CGANNNNNNTGC	2 cut(s)	205, 239
BcoDI	GTCTC	3 cut(s)	419, 594, 603
BfaI	CTAG	1 cut(s)	525
BisI	GCNGC	4 cut(s)	155, 412, 556, 621
BlsI	GCNGC	4 cut(s)	156, 413, 557, 622
BmgT120I	GGNCC	3 cut(s)	66, 485, 493
BpiI	GAAGAC	1 cut(s)	376
BplI	GAGNNNNNCTC	2 cut(s)	600, 632
BpmI	CTGGAG	1 cut(s)	388
Bpu14I	TTCGAA	2 cut(s)	77, 336
BsaI	GGTCTC	2 cut(s)	594, 603
BsaJI	CCNNGG	2 cut(s)	243, 604
BsaWI	WCCGGW	2 cut(s)	436, 578
BsaXI	ACNNNNNCTCC	2 cut(s)	387, 417
Bsc4I	CCNNNNNNNGG	3 cut(s)	63, 249, 596
Bse1I	ACTGG	1 cut(s)	371
BseAI	TCCGGA	1 cut(s)	578
BseDI	CCNNGG	2 cut(s)	243, 604
BseGI	GGATG	1 cut(s)	587
BseLI	CCNNNNNNNGG	3 cut(s)	63, 249, 596
BseNI	ACTGG	1 cut(s)	371
BseRI	GAGGAG	1 cut(s)	472
BseXI	GCAGC	1 cut(s)	141
BsgI	GTGCAG	1 cut(s)	631
Bsh1236I	CGCG	1 cut(s)	411
BshFI	GGCC	5 cut(s)	67, 486, 494, 586, 664
BsiSI	CCGG	2 cut(s)	437, 579
BslFI	GGGAC	1 cut(s)	499
BslI	CCNNNNNNNGG	3 cut(s)	63, 249, 596
BsmAI	GTCTC	3 cut(s)	419, 594, 603
BsmFI	GGGAC	1 cut(s)	499
BsnI	GGCC	5 cut(s)	67, 486, 494, 586, 664
Bso31I	GGTCTC	2 cut(s)	594, 603
Bsp119I	TTCGAA	2 cut(s)	77, 336
Bsp13I	TCCGGA	1 cut(s)	578
Bsp143I	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
Bsp19I	CCATGG	1 cut(s)	604
BspACI	CCGC	3 cut(s)	411, 556, 621
BspANI	GGCC	5 cut(s)	67, 486, 494, 586, 664
BspEI	TCCGGA	1 cut(s)	578
BspFNI	CGCG	1 cut(s)	411
BspPI	GGATC	3 cut(s)	286, 330, 365
BspT104I	TTCGAA	2 cut(s)	77, 336
BspTNI	GGTCTC	2 cut(s)	594, 603
BsrI	ACTGG	1 cut(s)	371
BssECI	CCNNGG	2 cut(s)	243, 604
BssMI	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
BssT1I	CCWWGG	1 cut(s)	604
Bst4CI	ACNGT	1 cut(s)	119
BstBI	TTCGAA	2 cut(s)	77, 336
BstC8I	GCNNGC	1 cut(s)	530
BstDSI	CCRYGG	1 cut(s)	604
BstF5I	GGATG	1 cut(s)	587
BstFNI	CGCG	1 cut(s)	411
BstKTI	GATC	7 cut(s)	281, 288, 325, 332, 360, 418, 450
BstMAI	GTCTC	3 cut(s)	419, 594, 603
BstMBI	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
BstMWI	GCNNNNNNNGC	1 cut(s)	654
BstUI	CGCG	1 cut(s)	411
BstV1I	GCAGC	1 cut(s)	141
BstV2I	GAAGAC	1 cut(s)	376
BsuRI	GGCC	5 cut(s)	67, 486, 494, 586, 664
BtgI	CCRYGG	1 cut(s)	604
BtgZI	GCGATG	1 cut(s)	283
BtsCI	GGATG	1 cut(s)	587
BtsI	GCAGTG	1 cut(s)	496
BtsIMutI	CAGTG	2 cut(s)	124, 496
Cac8I	GCNNGC	1 cut(s)	530
Cfr13I	GGNCC	3 cut(s)	66, 485, 493
CseI	GACGC	1 cut(s)	417
Csp6I	GTAC	1 cut(s)	190
CspCI	CAANNNNNGTGG	2 cut(s)	160, 195
CviAII	CATG	3 cut(s)	451, 593, 605
CviQI	GTAC	1 cut(s)	190
DpnI	GATC	7 cut(s)	280, 287, 324, 331, 359, 417, 449
DpnII	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
Eco130I	CCWWGG	1 cut(s)	604
Eco31I	GGTCTC	2 cut(s)	594, 603
Eco57I	CTGAAG	2 cut(s)	222, 370
EcoRI	GAATTC	1 cut(s)	13
EcoT14I	CCWWGG	1 cut(s)	604
ErhI	CCWWGG	1 cut(s)	604
FaeI	CATG	3 cut(s)	454, 596, 608
FaiI	YATR	4 cut(s)	452, 512, 594, 606
FaqI	GGGAC	1 cut(s)	499
FatI	CATG	3 cut(s)	450, 592, 604
Fnu4HI	GCNGC	4 cut(s)	155, 412, 556, 621
FokI	GGATG	1 cut(s)	594
Fsp4HI	GCNGC	4 cut(s)	155, 412, 556, 621
FspBI	CTAG	1 cut(s)	525
GluI	GCNGC	4 cut(s)	155, 412, 556, 621
GsuI	CTGGAG	1 cut(s)	388
HaeIII	GGCC	5 cut(s)	67, 486, 494, 586, 664
HapII	CCGG	2 cut(s)	437, 579
HgaI	GACGC	1 cut(s)	417
Hin1II	CATG	3 cut(s)	454, 596, 608
HindIII	AAGCTT	1 cut(s)	675
HinfI	GANTC	2 cut(s)	142, 535
HpaII	CCGG	2 cut(s)	437, 579
HphI	GGTGA	2 cut(s)	22, 100
Hpy188I	TCNGA	3 cut(s)	150, 407, 420
Hpy188III	TCNNGA	4 cut(s)	226, 276, 549, 579
Hpy99I	CGWCG	5 cut(s)	304, 345, 348, 383, 411
HpyAV	CCTTC	3 cut(s)	102, 206, 680
HpyCH4III	ACNGT	1 cut(s)	119
HpyCH4IV	ACGT	2 cut(s)	308, 352
HpyCH4V	TGCA	2 cut(s)	596, 648
HpyF10VI	GCNNNNNNNGC	1 cut(s)	654
HpySE526I	ACGT	2 cut(s)	308, 352
Hsp92II	CATG	3 cut(s)	454, 596, 608
Kpn2I	TCCGGA	1 cut(s)	578
Kzo9I	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
LmnI	GCTCC	1 cut(s)	369
Lsp1109I	GCAGC	1 cut(s)	141
MaeI	CTAG	1 cut(s)	525
MaeII	ACGT	2 cut(s)	308, 352
MaeIII	GTNAC	3 cut(s)	106, 254, 641
MalI	GATC	7 cut(s)	280, 287, 324, 331, 359, 417, 449
MboI	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
MboII	GAAGA	6 cut(s)	137, 206, 215, 241, 247, 376
MluCI	AATT	1 cut(s)	13
MmeI	TCCRAC	3 cut(s)	291, 335, 430
MnlI	CCTC	7 cut(s)	238, 297, 433, 450, 476, 597, 635
MroI	TCCGGA	1 cut(s)	578
MspI	CCGG	2 cut(s)	437, 579
MvnI	CGCG	1 cut(s)	411
MwoI	GCNNNNNNNGC	1 cut(s)	654
NcoI	CCATGG	1 cut(s)	604
NdeII	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
NlaIII	CATG	3 cut(s)	454, 596, 608
NmeAIII	GCCGAG	1 cut(s)	268
NmuCI	GTSAC	3 cut(s)	106, 254, 641
NspV	TTCGAA	2 cut(s)	77, 336
PcsI	WCGNNNNNNNCGW	2 cut(s)	281, 349
PfeI	GAWTC	2 cut(s)	142, 535
PkrI	GCNGC	4 cut(s)	156, 413, 557, 622
Psp1406I	AACGTT	1 cut(s)	352
PspPI	GGNCC	3 cut(s)	66, 485, 493
RsaI	GTAC	1 cut(s)	191
RsaNI	GTAC	1 cut(s)	190
SatI	GCNGC	4 cut(s)	155, 412, 556, 621
Sau3AI	GATC	7 cut(s)	278, 285, 322, 329, 357, 415, 447
Sau96I	GGNCC	3 cut(s)	66, 485, 493
SfuI	TTCGAA	2 cut(s)	77, 336
Sse9I	AATT	1 cut(s)	13
SsiI	CCGC	3 cut(s)	411, 556, 621
SspMI	CTAG	1 cut(s)	525
StyI	CCWWGG	1 cut(s)	604
TaaI	ACNGT	1 cut(s)	119
TaiI	ACGT	2 cut(s)	311, 355
TaqI	TCGA	5 cut(s)	31, 77, 292, 336, 548
TasI	AATT	1 cut(s)	13
TauI	GCSGC	3 cut(s)	414, 558, 623
TfiI	GAWTC	2 cut(s)	142, 535
TscAI	CASTG	2 cut(s)	124, 503
TseFI	GTSAC	3 cut(s)	106, 254, 641
TseI	GCWGC	1 cut(s)	154
Tsp45I	GTSAC	3 cut(s)	106, 254, 641
TspDTI	ATGAA	3 cut(s)	75, 248, 364
TspRI	CASTG	2 cut(s)	124, 503
XapI	RAATTY	1 cut(s)	13
XspI	CTAG	1 cut(s)	525

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.