Rmu_sc0015466.1_g000005

Uncharacterised protein family UPF0052

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015466.1
OG0013634
Physical Location & Seq
Forward (+)
13254 .. 16403
3150 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015466.1_g000005.1.cds

Sequence Viewer

Length: 768 bp
atggcttattgtggacagggaagctcttcagctcctgcactctcttcgaggataaagagggtattctacatgtcaagtgagggccaaaacttgcttcatgaggtcttccctgctccaaacccaggtgtgatggatcagctacataatgtggattgcattgtttatgccatgggttctctctttacttccgtttgcccatcactggtattaattggcattggggagattatatcttcaagtgaaaaagcaaagacctttgagaatcttccgaagctgcagttgatttcagccaccaacattggagtttggtacgaagaagctgaagatttggaaggcaaagtggtcgggaagatgaagaaagccgaggcaaggagtgacaaggagtggcgatggtcgggatcgccgatcaatcgaacggcgacgaggacgttggagtggctggatcgccgatcattcgaacgacgacgagaacgttggatcgccgactggagcttcatcgtcgtcttcaggtttggactgcatctccggcgtggcgatcagagagagagacagaccggaggtctatcccaggcttattgtggacagggaagctcttcagctcctgcactctcttcgaggataaagaggttccattccaagttcgacccaggaatagtttccaattgtcttgatggtggaaggccgttggcagccgtcgaaggggtgatgggtgatgtgctcatattttcctatatttatatgcctcttaatcttggtatttatgtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UPF0052

Protein Analysis

255

Amino Acids

28.45

Weight (kDa)

8.96

Isoelectric Point (pI)

62.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 472
AclWI GGATC 4 cut(s) 141, 406, 450, 485
AcuI CTGAAG 4 cut(s) 12, 342, 490, 579
AfaI GTAC 1 cut(s) 311
AfiI CCNNNNNNNGG 4 cut(s) 122, 202, 369, 699
AflIII ACRYGT 1 cut(s) 69
AgsI TTSAA 1 cut(s) 237
AhdI GACNNNNNGTC 1 cut(s) 558
AjnI CCWGG 3 cut(s) 121, 567, 646
AjuI GAANNNNNNNTTGG 2 cut(s) 78, 110
AluBI AGCT 8 cut(s) 24, 32, 139, 274, 320, 492, 591, 599
AluI AGCT 8 cut(s) 24, 32, 139, 274, 320, 492, 591, 599
Alw21I GWGCWC 1 cut(s) 720
Alw26I GTCTC 1 cut(s) 541
AlwI GGATC 4 cut(s) 141, 406, 450, 485
AlwNI CAGNNNCTG 2 cut(s) 35, 602
AoxI GGCC 2 cut(s) 82, 680
ApeKI GCWGC 2 cut(s) 274, 689
AseI ATTAAT 1 cut(s) 209
Asp700I GAANNNNTTC 3 cut(s) 25, 592, 655
AspS9I GGNCC 1 cut(s) 82
AsuHPI GGTGA 2 cut(s) 715, 722
AsuII TTCGAA 1 cut(s) 456
BbsI GAAGAC 2 cut(s) 97, 496
Bbv12I GWGCWC 1 cut(s) 720
BbvI GCAGC 2 cut(s) 261, 701
BccI CCATC 5 cut(s) 124, 205, 384, 665, 700
BceAI ACGGC 3 cut(s) 432, 667, 677
BcgI CGANNNNNNTGC 6 cut(s) 27, 61, 325, 359, 594, 628
BciT130I CCWGG 3 cut(s) 123, 569, 648
BcoDI GTCTC 1 cut(s) 541
BfmI CTRYAG 1 cut(s) 275
BisI GCNGC 2 cut(s) 275, 690
BlsI GCNGC 2 cut(s) 276, 691
Bme1390I CCNGG 3 cut(s) 123, 569, 648
BmeRI GACNNNNNGTC 1 cut(s) 558
BmgT120I GGNCC 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 629
BmrFI CCNGG 3 cut(s) 123, 569, 648
BmsI GCATC 1 cut(s) 529
BpiI GAAGAC 2 cut(s) 97, 496
BpmI CTGGAG 1 cut(s) 508
Bpu14I TTCGAA 1 cut(s) 456
BsaJI CCNNGG 5 cut(s) 121, 168, 363, 567, 646
BsaWI WCCGGW 1 cut(s) 554
BsaXI ACNNNNNCTCC 2 cut(s) 507, 537
Bsc4I CCNNNNNNNGG 4 cut(s) 122, 202, 369, 699
Bse1I ACTGG 2 cut(s) 207, 491
BseBI CCWGG 3 cut(s) 123, 569, 648
BseDI CCNNGG 5 cut(s) 121, 168, 363, 567, 646
BseLI CCNNNNNNNGG 4 cut(s) 122, 202, 369, 699
BseNI ACTGG 2 cut(s) 207, 491
BseXI GCAGC 2 cut(s) 261, 701
BsgI GTGCAG 2 cut(s) 21, 588
BshFI GGCC 2 cut(s) 84, 682
BsiHKAI GWGCWC 1 cut(s) 720
BsiSI CCGG 2 cut(s) 526, 555
BslI CCNNNNNNNGG 4 cut(s) 122, 202, 369, 699
BsmAI GTCTC 1 cut(s) 541
BsnI GGCC 2 cut(s) 84, 682
Bsp119I TTCGAA 1 cut(s) 456
Bsp1286I GDGCHC 1 cut(s) 720
Bsp143I GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
Bsp19I CCATGG 1 cut(s) 168
BspANI GGCC 2 cut(s) 84, 682
BspHI TCATGA 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 629
BspMAI CTGCAG 1 cut(s) 279
BspPI GGATC 4 cut(s) 141, 406, 450, 485
BspQI GCTCTTC 2 cut(s) 31, 598
BspT104I TTCGAA 1 cut(s) 456
BsrI ACTGG 2 cut(s) 207, 491
BssECI CCNNGG 5 cut(s) 121, 168, 363, 567, 646
BssMI GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
BssT1I CCWWGG 1 cut(s) 168
Bst2UI CCWGG 3 cut(s) 123, 569, 648
Bst6I CTCTTC 4 cut(s) 31, 49, 598, 616
BstBI TTCGAA 1 cut(s) 456
BstDSI CCRYGG 1 cut(s) 168
BstKTI GATC 7 cut(s) 136, 401, 408, 445, 452, 480, 538
BstMAI GTCTC 1 cut(s) 541
BstMBI GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
BstMWI GCNNNNNNNGC 1 cut(s) 526
BstNI CCWGG 3 cut(s) 123, 569, 648
BstNSI RCATGY 1 cut(s) 73
BstSCI CCNGG 3 cut(s) 121, 567, 646
BstSFI CTRYAG 1 cut(s) 275
BstV1I GCAGC 2 cut(s) 261, 701
BstV2I GAAGAC 2 cut(s) 97, 496
BsuRI GGCC 2 cut(s) 84, 682
BtgI CCRYGG 1 cut(s) 168
BtgZI GCGATG 1 cut(s) 403
BtsIMutI CAGTG 1 cut(s) 200
CaiI CAGNNNCTG 2 cut(s) 35, 602
CciI TCATGA 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 82
Csp6I GTAC 1 cut(s) 310
CspCI CAANNNNNGTGG 2 cut(s) 280, 315
CviAII CATG 3 cut(s) 70, 98, 169
CviQI GTAC 1 cut(s) 310
DpnI GATC 7 cut(s) 135, 400, 407, 444, 451, 479, 537
DpnII GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
DriI GACNNNNNGTC 1 cut(s) 558
Eam1104I CTCTTC 4 cut(s) 31, 49, 598, 616
Eam1105I GACNNNNNGTC 1 cut(s) 558
EarI CTCTTC 4 cut(s) 31, 49, 598, 616
Eco130I CCWWGG 1 cut(s) 168
Eco57I CTGAAG 4 cut(s) 12, 342, 490, 579
EcoRII CCWGG 3 cut(s) 121, 567, 646
EcoT14I CCWWGG 1 cut(s) 168
ErhI CCWWGG 1 cut(s) 168
FaeI CATG 3 cut(s) 73, 101, 172
FatI CATG 3 cut(s) 69, 97, 168
Fnu4HI GCNGC 2 cut(s) 275, 690
Fsp4HI GCNGC 2 cut(s) 275, 690
GluI GCNGC 2 cut(s) 275, 690
GsuI CTGGAG 1 cut(s) 508
HaeIII GGCC 2 cut(s) 84, 682
HapII CCGG 2 cut(s) 526, 555
Hin1II CATG 3 cut(s) 73, 101, 172
HinfI GANTC 1 cut(s) 262
HpaII CCGG 2 cut(s) 526, 555
HphI GGTGA 2 cut(s) 715, 722
Hpy166II GTNNAC 2 cut(s) 14, 581
Hpy188I TCNGA 2 cut(s) 270, 540
Hpy188III TCNNGA 4 cut(s) 98, 346, 396, 668
Hpy8I GTNNAC 2 cut(s) 14, 581
Hpy99I CGWCG 5 cut(s) 424, 465, 468, 503, 698
HpyAV CCTTC 3 cut(s) 326, 672, 692
HpyCH4IV ACGT 2 cut(s) 428, 472
HpyCH4V TGCA 5 cut(s) 38, 156, 277, 520, 605
HpyF10VI GCNNNNNNNGC 1 cut(s) 526
HpySE526I ACGT 2 cut(s) 428, 472
Hsp92II CATG 3 cut(s) 73, 101, 172
Kzo9I GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
LguI GCTCTTC 2 cut(s) 31, 598
LmnI GCTCC 4 cut(s) 37, 118, 489, 604
Lsp1109I GCAGC 2 cut(s) 261, 701
LweI GCATC 1 cut(s) 529
MaeII ACGT 2 cut(s) 428, 472
MaeIII GTNAC 1 cut(s) 374
MalI GATC 7 cut(s) 135, 400, 407, 444, 451, 479, 537
MboI GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
MfeI CAATTG 1 cut(s) 661
MhlI GDGCHC 1 cut(s) 720
MluCI AATT 2 cut(s) 210, 661
MmeI TCCRAC 2 cut(s) 411, 455
MroXI GAANNNNTTC 3 cut(s) 25, 592, 655
MseI TTAA 2 cut(s) 209, 747
MspI CCGG 2 cut(s) 526, 555
MspR9I CCNGG 3 cut(s) 123, 569, 648
MunI CAATTG 1 cut(s) 661
MvaI CCWGG 3 cut(s) 123, 569, 648
MwoI GCNNNNNNNGC 1 cut(s) 526
NcoI CCATGG 1 cut(s) 168
NdeII GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
NlaIII CATG 3 cut(s) 73, 101, 172
NlaIV GGNNCC 1 cut(s) 629
NmeAIII GCCGAG 1 cut(s) 388
NmuCI GTSAC 1 cut(s) 374
NspI RCATGY 1 cut(s) 73
NspV TTCGAA 1 cut(s) 456
PagI TCATGA 1 cut(s) 97
PciI ACATGT 1 cut(s) 69
PciSI GCTCTTC 2 cut(s) 31, 598
PcsI WCGNNNNNNNCGW 2 cut(s) 401, 469
PdmI GAANNNNTTC 3 cut(s) 25, 592, 655
PfeI GAWTC 1 cut(s) 262
PkrI GCNGC 2 cut(s) 276, 691
PscI ACATGT 1 cut(s) 69
PshBI ATTAAT 1 cut(s) 209
Psp1406I AACGTT 1 cut(s) 472
Psp6I CCWGG 3 cut(s) 121, 567, 646
PspGI CCWGG 3 cut(s) 121, 567, 646
PspN4I GGNNCC 1 cut(s) 629
PspPI GGNCC 1 cut(s) 82
PstI CTGCAG 1 cut(s) 279
PstNI CAGNNNCTG 2 cut(s) 35, 602
RsaI GTAC 1 cut(s) 311
RsaNI GTAC 1 cut(s) 310
SapI GCTCTTC 2 cut(s) 31, 598
SaqAI TTAA 2 cut(s) 209, 747
SatI GCNGC 2 cut(s) 275, 690
Sau3AI GATC 7 cut(s) 133, 398, 405, 442, 449, 477, 535
Sau96I GGNCC 1 cut(s) 82
ScrFI CCNGG 3 cut(s) 123, 569, 648
SduI GDGCHC 1 cut(s) 720
SfaNI GCATC 1 cut(s) 529
SfcI CTRYAG 1 cut(s) 275
SfuI TTCGAA 1 cut(s) 456
Sse9I AATT 2 cut(s) 210, 661
StyD4I CCNGG 3 cut(s) 121, 567, 646
StyI CCWWGG 1 cut(s) 168
TaiI ACGT 2 cut(s) 431, 475
TaqI TCGA 6 cut(s) 47, 412, 456, 614, 642, 696
TasI AATT 2 cut(s) 210, 661
TfiI GAWTC 1 cut(s) 262
Tru1I TTAA 2 cut(s) 209, 747
Tru9I TTAA 2 cut(s) 209, 747
TscAI CASTG 1 cut(s) 207
TseFI GTSAC 1 cut(s) 374
TseI GCWGC 2 cut(s) 274, 689
Tsp45I GTSAC 1 cut(s) 374
TspDTI ATGAA 3 cut(s) 86, 368, 484
TspGWI ACGGA 1 cut(s) 178
TspRI CASTG 1 cut(s) 207
VspI ATTAAT 1 cut(s) 209
XceI RCATGY 1 cut(s) 73
XcmI CCANNNNNNNNNTGG 1 cut(s) 575
XmnI GAANNNNTTC 3 cut(s) 25, 592, 655
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.