RchiOBHm_Chr5g0045731
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
41726015 .. 41732192
6178 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32379

Sequence Viewer

Length: 288 bp
ATGCCTTCAGAGATCCTGAATGAGAAACATGACGATCTTGACAAGGCTGATATCTTCTCATTGGGAGTTGCTATGTATGAGCTTATTAGAGGTTCACCGTTACCGGAAGAAGGACCTCAAACCTTAAATCTTAAGAAAGGAAAATTGCCACTGCTTCCTGGTCACTCCTTGCAACTTCAGAACTTGCTCAAGGCCATGTTGGATCCAAATCCAGTCTGCAGACCATCAGCTAAAGAGTTGGTTGAAAATCTAATGTTCCACAGGGTGCTAAAAAATGCATGGGCCTAG

Protein Analysis

95

Amino Acids

10.64

Weight (kDa)

6.27

Isoelectric Point (pI)

45.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 1 - 83 1.9e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 7, 197, 210
AcuI CTGAAG 1 cut(s) 161
AdeI CACNNNGTG 1 cut(s) 265
AfiI CCNNNNNNNGG 1 cut(s) 110
AflII CTTAAG 1 cut(s) 131
AgsI TTSAA 1 cut(s) 245
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 2 cut(s) 82, 230
AluI AGCT 2 cut(s) 82, 230
AlwI GGATC 3 cut(s) 7, 197, 210
AoxI GGCC 2 cut(s) 192, 282
AspS9I GGNCC 2 cut(s) 113, 282
AsuHPI GGTGA 1 cut(s) 87
AvaII GGWCC 1 cut(s) 113
BamHI GGATCC 1 cut(s) 202
BccI CCATC 1 cut(s) 232
BciT130I CCWGG 1 cut(s) 159
BfaI CTAG 1 cut(s) 286
BfmI CTRYAG 1 cut(s) 217
BfrI CTTAAG 1 cut(s) 131
Bme1390I CCNGG 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 113
BmgT120I GGNCC 2 cut(s) 113, 282
BmiI GGNNCC 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 173
BsaBI GATNNNNATC 1 cut(s) 207
BsaWI WCCGGW 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 212
Bse8I GATNNNNATC 1 cut(s) 207
BseBI CCWGG 1 cut(s) 159
BseJI GATNNNNATC 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 212
BshFI GGCC 2 cut(s) 194, 284
BsiSI CCGG 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 110
BsnI GGCC 2 cut(s) 194, 284
Bsp143I GATC 3 cut(s) 12, 34, 202
BspANI GGCC 2 cut(s) 194, 284
BspLI GGNNCC 1 cut(s) 204
BspMAI CTGCAG 1 cut(s) 221
BspPI GGATC 3 cut(s) 7, 197, 210
BspTI CTTAAG 1 cut(s) 131
BsrI ACTGG 1 cut(s) 212
BssMI GATC 3 cut(s) 12, 34, 202
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 99
BstAFI CTTAAG 1 cut(s) 131
BstKTI GATC 3 cut(s) 15, 37, 205
BstMBI GATC 3 cut(s) 12, 34, 202
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstSFI CTRYAG 1 cut(s) 217
BstX2I RGATCY 2 cut(s) 12, 202
BstYI RGATCY 2 cut(s) 12, 202
BsuRI GGCC 2 cut(s) 194, 284
BtsI GCAGTG 1 cut(s) 149
BtsIMutI CAGTG 1 cut(s) 149
Cfr13I GGNCC 2 cut(s) 113, 282
CviAII CATG 3 cut(s) 29, 196, 279
CviJI RGCY 5 cut(s) 47, 82, 194, 230, 284
CviKI_1 RGCY 5 cut(s) 47, 82, 194, 230, 284
DpnI GATC 3 cut(s) 14, 36, 204
DpnII GATC 3 cut(s) 12, 34, 202
DraIII CACNNNGTG 1 cut(s) 265
Eco32I GATATC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 113
Eco57I CTGAAG 1 cut(s) 161
EcoO109I RGGNCCY 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 157
EcoRV GATATC 1 cut(s) 52
EcoT22I ATGCAT 1 cut(s) 280
FaeI CATG 3 cut(s) 32, 199, 282
FaiI YATR 5 cut(s) 30, 74, 78, 197, 280
FatI CATG 3 cut(s) 28, 195, 278
FspBI CTAG 1 cut(s) 286
HaeIII GGCC 2 cut(s) 194, 284
HapII CCGG 1 cut(s) 104
Hin1II CATG 3 cut(s) 32, 199, 282
HpaII CCGG 1 cut(s) 104
HphI GGTGA 1 cut(s) 87
Hpy166II GTNNAC 1 cut(s) 95
Hpy188I TCNGA 2 cut(s) 10, 180
Hpy188III TCNNGA 2 cut(s) 16, 38
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 2 cut(s) 15, 104
HpyCH4III ACNGT 1 cut(s) 99
HpyCH4V TGCA 3 cut(s) 172, 219, 278
Hsp92II CATG 3 cut(s) 32, 199, 282
Kzo9I GATC 3 cut(s) 12, 34, 202
LpnPI CCDG 6 cut(s) 29, 117, 144, 171, 225, 247
MaeI CTAG 1 cut(s) 286
MaeIII GTNAC 2 cut(s) 99, 161
MalI GATC 3 cut(s) 14, 36, 204
MboI GATC 3 cut(s) 12, 34, 202
MboII GAAGA 2 cut(s) 46, 119
MflI RGATCY 2 cut(s) 12, 202
MluCI AATT 1 cut(s) 143
MmeI TCCRAC 1 cut(s) 180
MnlI CCTC 2 cut(s) 83, 126
Mph1103I ATGCAT 1 cut(s) 280
MseI TTAA 2 cut(s) 125, 132
MspCI CTTAAG 1 cut(s) 131
MspI CCGG 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NdeII GATC 3 cut(s) 12, 34, 202
NlaIII CATG 3 cut(s) 32, 199, 282
NlaIV GGNNCC 1 cut(s) 204
NmuCI GTSAC 1 cut(s) 161
NsiI ATGCAT 1 cut(s) 280
PpuMI RGGWCCY 1 cut(s) 113
Psp5II RGGWCCY 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 1 cut(s) 204
PspPI GGNCC 2 cut(s) 113, 282
PspPPI RGGWCCY 1 cut(s) 113
PstI CTGCAG 1 cut(s) 221
PsuI RGATCY 2 cut(s) 12, 202
SaqAI TTAA 2 cut(s) 125, 132
Sau3AI GATC 3 cut(s) 12, 34, 202
Sau96I GGNCC 2 cut(s) 113, 282
ScrFI CCNGG 1 cut(s) 159
SetI ASST 5 cut(s) 84, 94, 118, 125, 232
SfcI CTRYAG 1 cut(s) 217
SinI GGWCC 1 cut(s) 113
SmlI CTYRAG 2 cut(s) 131, 188
SmoI CTYRAG 2 cut(s) 131, 188
Sse9I AATT 1 cut(s) 143
SspMI CTAG 1 cut(s) 286
StyD4I CCNGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 99
TasI AATT 1 cut(s) 143
Tru1I TTAA 2 cut(s) 125, 132
Tru9I TTAA 2 cut(s) 125, 132
TscAI CASTG 1 cut(s) 156
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
TspRI CASTG 1 cut(s) 156
Vha464I CTTAAG 1 cut(s) 131
VpaK11BI GGWCC 1 cut(s) 113
XspI CTAG 1 cut(s) 286
Zsp2I ATGCAT 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.